Variations and Similarities within the Peptide Profile of Preterm and Time period Mom’s Milk


Variations and Similarities within the Peptide Profile of Preterm and Time period Mom’s Milk, and Preterm and Time period Toddler Gastric Samples

Our earlier research revealed that milk proteases start to hydrolyze proteins within the mammary gland and that proteolytic digestion continues throughout the toddler abdomen. No analysis has measured how the discharge of milk peptides differs between the gastric aspirates of time period and untimely infants.

This examine examined the presence of milk peptides in milk and gastric samples from time period and preterm infants utilizing an Orbitrap Fusion Lumos mass spectrometer. Samples have been collected from 9 preterm-delivering and 4 term-delivering mother-infant pairs. Our examine reveals an elevated rely and ion abundance of peptides and decreased peptide size from mom’s milk to the toddler abdomen, confirming that further break-down of the milk proteins occurred in each preterm and time period infants’ stomachs.

Protein digestion occurred at a better degree within the gastric contents of time period infants than in gastric contents of preterm infants. An amino acid cleavage site-based enzyme evaluation urged that the noticed increased proteolysis within the time period infants was as a consequence of increased pepsin/cathepsin D exercise within the abdomen. Moreover, there was a better amount of antimicrobial peptides in time period toddler gastric contents than in these of preterm infants, which might point out that preterm infants profit much less from bioactive peptides within the intestine. 

Strong Magnetized Graphene Oxide Platform for In Situ Peptide Synthesis and FRET-Primarily based Protease Detection

Graphene oxide (GO)/peptide complexes as a promising illness biomarker evaluation platform have been used to detect proteolytic exercise by observing the turn-on sign of the quenched fluorescence upon the discharge of peptide fragments.

Nevertheless, the purification steps are sometimes cumbersome throughout floor modification of nano-/micro-sized GO. As well as, it’s nonetheless difficult to include the particular peptides into GO with correct orientation utilizing standard immobilization strategies primarily based on pre-synthesized peptides.

Right here, we exhibit a sturdy magnetic GO (MGO) fluorescence resonance vitality switch (FRET) platform primarily based on in situ sequence-specific peptide synthesis of MGO. The magnetization of GO was achieved by co-precipitation of an iron precursor resolution. Magnetic purification/isolation enabled environment friendly incorporation of amino-polyethylene glycol spacers and subsequent solid-phase peptide synthesis of MGO to make sure the oriented immobilization of the peptide, which was evaluated by mass spectrometry after photocleavage. The FRET peptide MGO responded to proteases resembling trypsin, thrombin, and β-secretase in a concentration-dependent method.

Significantly, β-secretase, as an necessary Alzheimer’s illness marker, was assayed all the way down to 0.125 ng/mL. General, the MGO platform is relevant to the detection of different proteases by utilizing numerous peptide substrates, with a possible for use in an automatic synthesis system working in a excessive throughput configuration. 


IRF4 Blocking Peptide

AF0692-BP 1mg
EUR 195

IRF4 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IRF4 Blocking Peptide

DF6198-BP 1mg
EUR 195

Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit

DLR-IRF4-Ra-48T 48T
EUR 475
  • Should the Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interferon Regulatory Factor 4 (IRF4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit

DLR-IRF4-Ra-96T 96T
EUR 616
  • Should the Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interferon Regulatory Factor 4 (IRF4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit

RD-IRF4-Ra-48Tests 48 Tests
EUR 473

Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit

RD-IRF4-Ra-96Tests 96 Tests
EUR 655

Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit

RDR-IRF4-Ra-48Tests 48 Tests
EUR 495

Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit

RDR-IRF4-Ra-96Tests 96 Tests
EUR 685

phospho-IRF4(Tyr122/125) Blocking Peptide

AF4476-BP 1mg
EUR 195

IRF4 Antibody

AF4776 200ul
EUR 376
Description: IRF4 Antibody detects endogenous levels of IRF4.

IRF4 Antibody

AF0692 200ul
EUR 304
Description: IRF4 Antibody detects endogenous levels of IRF4.

IRF4 Antibody

ABF0692 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IRF4 antibody

70R-51567 100 ul
EUR 244
Description: Purified Polyclonal IRF4 antibody

IRF4 antibody

70R-31899 100 ug
EUR 327
Description: Rabbit polyclonal IRF4 antibody

IRF4 Antibody

ABD6198 100 ug
EUR 438

IRF4 Antibody

37663-100ul 100ul
EUR 252

IRF4 antibody

38169-100ul 100ul
EUR 252

IRF4 Antibody

33893-100ul 100ul
EUR 252

IRF4 Antibody

33893-50ul 50ul
EUR 187

IRF4 Antibody

43509-100ul 100ul
EUR 252

IRF4 Antibody

25305-100ul 100ul
EUR 390

IRF4 antibody

70R-18008 50 ul
EUR 435
Description: Rabbit polyclonal IRF4 antibody

IRF4 Antibody

DF6198 200ul
EUR 304
Description: IRF4 Antibody detects endogenous levels of total IRF4.

IRF4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

IRF4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IRF4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

IRF4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

IRF4 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

IRF4 Antibody

CSB-PA250376-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

IRF4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

IRF4 Conjugated Antibody

C37663 100ul
EUR 397

IRF4 Conjugated Antibody

C38169 100ul
EUR 397

Polyclonal IRF4 Antibody

APR06706G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF4 . This antibody is tested and proven to work in the following applications:

IRF4 cloning plasmid

CSB-CL011819HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgaacctggagggcggcggccgaggcggagagttcggcatgagcgcggtgagctgcggcaacgggaagctccgccagtggctgatcgaccagatcgacagcggcaagtaccccgggctggtgtgggagaacgaggagaagagcatcttccgcatcccctggaagcacgcgggca
  • Show more
Description: A cloning plasmid for the IRF4 gene.

anti- IRF4 antibody

FNab04390 100µg
EUR 548.75
  • Immunogen: interferon regulatory factor 4
  • Uniprot ID: Q15306
  • Gene ID: 3662
  • Research Area: Epigenetics, Cancer, Metabolism
Description: Antibody raised against IRF4

IRF4 Rabbit pAb

A0524-100ul 100 ul
EUR 308

IRF4 Rabbit pAb

A0524-200ul 200 ul
EUR 459

IRF4 Rabbit pAb

A0524-20ul 20 ul
EUR 183

IRF4 Rabbit pAb

A0524-50ul 50 ul
EUR 223

IRF4 Rabbit pAb

A1052-100ul 100 ul
EUR 308

IRF4 Rabbit pAb

A1052-200ul 200 ul
EUR 459

IRF4 Rabbit pAb

A1052-20ul 20 ul
EUR 183

IRF4 Rabbit pAb

A1052-50ul 50 ul
EUR 223

Anti-IRF4 antibody

PAab04390 100 ug
EUR 386

anti-IRF4 (2F2)

LF-MA10153 100 ug
EUR 363
Description: Mouse monoclonal to IRF4

Anti-IRF4 antibody

STJ72734 100 µg
EUR 359

Anti-IRF4 antibody

STJ24229 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene.


EF010383 96 Tests
EUR 689

Mouse IRF4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IRF4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-MUM1/IRF4 Antibody

PB9222 100ug/vial
EUR 334

IRF4 Recombinant Protein (Human)

RP016315 100 ug Ask for price


PVT19082 2 ug
EUR 258

IRF4 Recombinant Protein (Rat)

RP206234 100 ug Ask for price

IRF4 Recombinant Protein (Mouse)

RP144200 100 ug Ask for price

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672

Polyclonal IRF4 Antibody (C-Terminus)

APR02881G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF4 (C-Terminus). This antibody is tested and proven to work in the following applications:

phospho-IRF4(Tyr122/125) Antibody

AF4476 200ul
EUR 376
Description: phospho-IRF4(Y122/125) antibod detects endogenous levels of phospho-IRF4 only when phosphorylated at Y122/125.

Polyclonal IRF4 Antibody (C-Term)

APG00796G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IRF4 (C-Term). This antibody is tested and proven to work in the following applications:

IRF4 Colorimetric Cell-Based ELISA

EKC1819 100ul
EUR 572

IRF4(Phospho-Tyr122/125) antibody

12846-100ul 100ul
EUR 252

IRF4(Phospho-Tyr122/125) antibody

12846-50ul 50ul
EUR 187

Recombinant Human IRF4 / MUM-1

7-05413 2µg Ask for price

Recombinant Human IRF4 / MUM-1

7-05414 5µg Ask for price

Recombinant Human IRF4 / MUM-1

7-05415 10µg Ask for price

IRF4 ORF Vector (Human) (pORF)

ORF005439 1.0 ug DNA
EUR 95

Irf4 ORF Vector (Rat) (pORF)

ORF068746 1.0 ug DNA
EUR 506

Irf4 ORF Vector (Mouse) (pORF)

ORF048068 1.0 ug DNA
EUR 506

pECMV-Irf4-m-FLAG Plasmid

PVT14835 2 ug
EUR 325

A rationally designed bicyclic peptide remodels Aβ42 aggregation in vitro and reduces its toxicity in a worm mannequin of Alzheimer’s illness

Bicyclic peptides have nice therapeutic potential since they will bridge the hole between small molecules and antibodies by combining a low molecular weight of about 2 kDa with an antibody-like binding specificity. Right here we apply a not too long ago developed in silico rational design technique to provide a bicyclic peptide to focus on the C-terminal area (residues 31-42) of the 42-residue type of the amyloid β peptide (Aβ42), a protein fragment whose aggregation into amyloid plaques is linked with Alzheimer’s illness. 

We present that this bicyclic peptide is ready to transform the aggregation strategy of Aβ42 in vitro and to cut back its related toxicity in vivo in a C. elegans worm mannequin expressing Aβ42. These outcomes present an preliminary instance of a computational method to design bicyclic peptides to focus on particular epitopes on disordered proteins. 

Attenuating the Choice of Vancomycin Resistance Amongst Enterococci Via the Improvement of Peptide-Primarily based Vancomycin Antagonists

The emergence and unfold of multidrug resistant (MDR) pathogens with acquired resistance to nearly all accessible antimicrobial brokers has severely threatened the worldwide healthcare neighborhood over the past 20 years.

The final resort antibiotic vancomycin is important for therapy of a number of of those pathogens, nonetheless vancomycin resistance is spreading as a result of undesired accumulation of IV vancomycin within the colon post-treatment. This accumulation exerts selective strain upon members of the colonic microflora, together with Enterococci, that possess vancomycin resistance genes.

With a purpose to make sure the continuous effectiveness of vancomycin within the scientific setting by stopping the unfold of antibiotic resistance, it’s essential to develop methods that cut back selective strain on the colonic microflora whereas permitting vancomycin to take care of its desired exercise on the web site of an infection. Herein we report that modification of the native L-Lys-D-Ala-D-Ala vancomycin binding web site can be utilized to provide peptides with the flexibility to competitively bind vancomycin, lowering its exercise towards vulnerable Enterococci. 

Furthermore, a number of modifications to the N-termini of the native tripeptide have produced compounds with enhanced vancomycin binding exercise, together with a number of analogs that have been designed to covalently bind vancomycin, thereby appearing as suicide inhibitors. Lastly, in a blended tradition of vulnerable and resistant micro organism, a single lead compound was discovered to guard excessive ratios of vulnerable micro organism from vancomycin over the course of a week-long interval, stopping the choice for vancomycin-resistant Enterococci.

 These findings exhibit the flexibility of those peptides as potential therapeutic adjuvants for counteracting the undesired accumulation of colonic vancomycin, permitting for cover of the colonic microflora. 

Polyclonal DISP2 Antibody

APR06514G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP2 . This antibody is tested and proven to work in the following applications:

Mouse DISP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DISP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004867 96 Tests
EUR 689

Disp2 ORF Vector (Rat) (pORF)

ORF066035 1.0 ug DNA
EUR 2080

Disp2 ORF Vector (Mouse) (pORF)

ORF043041 1.0 ug DNA
EUR 1572

DISP2 ORF Vector (Human) (pORF)

ORF018359 1.0 ug DNA
EUR 405

DISP2 sgRNA CRISPR Lentivector set (Human)

K0604801 3 x 1.0 ug
EUR 339

Disp2 sgRNA CRISPR Lentivector set (Mouse)

K3612501 3 x 1.0 ug
EUR 339

Disp2 sgRNA CRISPR Lentivector set (Rat)

K6641301 3 x 1.0 ug
EUR 339

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672

DISP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0604802 1.0 ug DNA
EUR 154

DISP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0604803 1.0 ug DNA
EUR 154

DISP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0604804 1.0 ug DNA
EUR 154

Disp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3612502 1.0 ug DNA
EUR 154

Disp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3612503 1.0 ug DNA
EUR 154

Disp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3612504 1.0 ug DNA
EUR 154

Disp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6641302 1.0 ug DNA
EUR 154

Disp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6641303 1.0 ug DNA
EUR 154

Disp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6641304 1.0 ug DNA
EUR 154

DISP2 Protein Vector (Human) (pPB-C-His)

PV073433 500 ng Ask for price

DISP2 Protein Vector (Human) (pPB-N-His)

PV073434 500 ng Ask for price

DISP2 Protein Vector (Human) (pPM-C-HA)

PV073435 500 ng Ask for price

DISP2 Protein Vector (Human) (pPM-C-His)

PV073436 500 ng Ask for price

DISP2 Protein Vector (Mouse) (pPB-C-His)

PV172162 500 ng
EUR 2302

DISP2 Protein Vector (Mouse) (pPB-N-His)

PV172163 500 ng
EUR 2302

DISP2 Protein Vector (Mouse) (pPM-C-HA)

PV172164 500 ng
EUR 2302

DISP2 Protein Vector (Mouse) (pPM-C-His)

PV172165 500 ng
EUR 2302

DISP2 Protein Vector (Rat) (pPB-C-His)

PV264138 500 ng
EUR 2303

DISP2 Protein Vector (Rat) (pPB-N-His)

PV264139 500 ng
EUR 2303

DISP2 Protein Vector (Rat) (pPM-C-HA)

PV264140 500 ng
EUR 2303

DISP2 Protein Vector (Rat) (pPM-C-His)

PV264141 500 ng
EUR 2303

Disp2 3'UTR Luciferase Stable Cell Line

TU203430 1.0 ml Ask for price

Disp2 3'UTR GFP Stable Cell Line

TU155166 1.0 ml Ask for price

DISP2 3'UTR Luciferase Stable Cell Line

TU006038 1.0 ml
EUR 1394

Disp2 3'UTR Luciferase Stable Cell Line

TU105166 1.0 ml Ask for price

DISP2 3'UTR GFP Stable Cell Line

TU056038 1.0 ml
EUR 1394

Disp2 3'UTR GFP Stable Cell Line

TU253430 1.0 ml Ask for price

Mouse Protein dispatched homolog 2, Disp2 ELISA KIT

ELI-46875m 96 Tests
EUR 865

Human Protein dispatched homolog 2, DISP2 ELISA KIT

ELI-32162h 96 Tests
EUR 824

Human Protein dispatched homolog 2 (DISP2) ELISA Kit

abx384802-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein dispatched homolog 2 (DISP2) ELISA Kit

abx389082-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

DISP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621787 1.0 ug DNA
EUR 2157

DISP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621791 1.0 ug DNA
EUR 2157

DISP2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621792 1.0 ug DNA
EUR 2157

ELISA kit for Mouse Protein dispatched homolog 2 (DISP2)

KTE71270-48T 48T
EUR 332
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein dispatched homolog 2 (DISP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein dispatched homolog 2 (DISP2)

KTE71270-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein dispatched homolog 2 (DISP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein dispatched homolog 2 (DISP2)

KTE71270-96T 96T
EUR 539
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein dispatched homolog 2 (DISP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein dispatched homolog 2 (DISP2)

KTE62044-48T 48T
EUR 332
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 2 (DISP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein dispatched homolog 2 (DISP2)

KTE62044-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 2 (DISP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein dispatched homolog 2 (DISP2)

KTE62044-96T 96T
EUR 539
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 2 (DISP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Disp2 ELISA Kit| Mouse Protein dispatched homolog 2 ELISA Kit

EF014712 96 Tests
EUR 689

DISP2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0604805 3 x 1.0 ug
EUR 376

Disp2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3612505 3 x 1.0 ug
EUR 376

Disp2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6641305 3 x 1.0 ug
EUR 376

DISP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0604806 1.0 ug DNA
EUR 167

DISP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0604807 1.0 ug DNA
EUR 167

DISP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0604808 1.0 ug DNA
EUR 167

Disp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3612506 1.0 ug DNA
EUR 167

Disp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3612507 1.0 ug DNA
EUR 167

Disp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3612508 1.0 ug DNA
EUR 167

Disp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6641306 1.0 ug DNA
EUR 167

Leave a Reply

Your email address will not be published. Required fields are marked *

Human Verification: In order to verify that you are a human and not a spam bot, please enter the answer into the following box below based on the instructions contained in the graphic.