TNNI3 cDNA Clone, 0.01mg plasmid +0.2ml

TNNI3 cDNA Clone, 0.01mg plasmid +0.2ml 

To Order Contact us: caitlyn@ucb-bioproducts.com

TNNI3 cloning plasmid
CSB-CL024013HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: ATGGCGGATGGGAGCAGCGATGCGGCTAGGGAACCTCGCCCTGCACCAGCCCCAATCAGACGCCGCTCCTCCAACTACCGCGCTTATGCCACGGAGCCGCACGCCAAGAAAAAATCTAAGATCTCCGCCTCGAGAAAATTGCAGCTGAAGACTCTGCTGCTGCAGATTGCAAAGCA
  • Show more
Description: A cloning plasmid for the TNNI3 gene.

pDONR223-TNNI3 Plasmid
PVTB00179S 2 ug
EUR 356

Rat TNNI3 shRNA Plasmid
20-abx985379
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNNI3 shRNA Plasmid
20-abx954896
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TNNI3 shRNA Plasmid
20-abx973175
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-Hu-48T 48T
EUR 441
  • Should the Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-Hu-96T 96T
EUR 570
  • Should the Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-Mu-48T 48T
EUR 489
  • Should the Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-Mu-96T 96T
EUR 635
  • Should the Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-p-48T 48T
EUR 547
  • Should the Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-p-96T 96T
EUR 715
  • Should the Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-Ra-48T 48T
EUR 508
  • Should the Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
DLR-TNNI3-Ra-96T 96T
EUR 661
  • Should the Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Troponin I Type 3, Cardiac (TNNI3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-Hu-48Tests 48 Tests
EUR 455

Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-Hu-96Tests 96 Tests
EUR 629

Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-Mu-48Tests 48 Tests
EUR 511

Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-Mu-96Tests 96 Tests
EUR 709

Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-p-48Tests 48 Tests
EUR 580

Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-p-96Tests 96 Tests
EUR 807

Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-Ra-48Tests 48 Tests
EUR 534

Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RDR-TNNI3-Ra-96Tests 96 Tests
EUR 742

Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-Hu-48Tests 48 Tests
EUR 436

Human Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-Hu-96Tests 96 Tests
EUR 601

Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-Mu-48Tests 48 Tests
EUR 489

Mouse Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-Mu-96Tests 96 Tests
EUR 677

Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-p-48Tests 48 Tests
EUR 555

Porcine Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-p-96Tests 96 Tests
EUR 771

Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-Ra-48Tests 48 Tests
EUR 511

Rat Troponin I Type 3, Cardiac (TNNI3) ELISA Kit
RD-TNNI3-Ra-96Tests 96 Tests
EUR 709

Monoclonal TNNI3 Antibody (monoclonal) (M04), Clone: 1E8
AMM04223G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TNNI3 (monoclonal) (M04). The antibodies are raised in Mouse and are from clone 1E8. This antibody is applicable in WB, IHC and IF, E

0.2ml Adapter pack
C1008-A2-6 1 PC
EUR 84.94
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

0.2ml Adapter pack
C1008-A2-9 1 PC
EUR 395.96
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

TNNI3 Antibody
AF6214 200ul
EUR 304
Description: TNNI3 Antibody detects endogenous levels of total TNNI3.

TNNI3 Antibody
AF6215 200ul
EUR 304
Description: TNNI3 Antibody detects endogenous levels of total TNNI3.

TNNI3 siRNA
20-abx905717
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNI3 Antibody
AF7807 200ul
EUR 376
Description: TNNI3 Antibody detects endogenous levels of TNNI3.

TNNI3 Protein
abx069974-1mg 1 mg
EUR 1156
  • Shipped within 5-10 working days.

TNNI3 Antibody
ABF6214 100 ug
EUR 438

TNNI3 Antibody
ABF6215 100 ug
EUR 438

TNNI3 Antibody
20-abx330236
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TNNI3 Antibody
20-abx330255
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TNNI3 siRNA
20-abx937674
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNI3 siRNA
20-abx937675
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNI3 antibody
70R-36382 100 ug
EUR 327
Description: Rabbit polyclonal TNNI3 antibody

TNNI3 antibody
70R-35368 100 ug
EUR 327
Description: Purified Rabbit polyclonal TNNI3 antibody

TNNI3 Antibody
35662-100ul 100ul
EUR 252

TNNI3 antibody
10R-6090 100 ul
EUR 726
Description: Mouse monoclonal TNNI3 antibody

TNNI3 antibody
10R-6091 100 ul
EUR 691
Description: Mouse monoclonal TNNI3 antibody

TNNI3 antibody
10R-6092 100 ul
EUR 691
Description: Mouse monoclonal TNNI3 antibody

TNNI3 antibody
20R-2873 100 ul
EUR 349
Description: Rabbit polyclonal TNNI3 antibody

TNNI3 Antibody
1-CSB-PA004335
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

TNNI3 Antibody
1-CSB-PA006352
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

TNNI3 Antibody
1-CSB-PA006356
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Tnni3 Antibody
1-CSB-PA341785LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tnni3. Recognizes Tnni3 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

TNNI3 Antibody
1-CSB-PA133116
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

TNNI3 Antibody
1-CSB-PA07936A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

TNNI3 Antibody
1-CSB-PA07937A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

TNNI3 Antibody
1-CSB-PA119248
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

TNNI3 Antibody
1-CSB-PA050278
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

40 x 0.2mL block / 8 x 0.2mL strip, accessory for Palm?
ACT-PALM-24A
EUR 124

TNNI3 Blocking Peptide
AF6214-BP 1mg
EUR 195

TNNI3 Blocking Peptide
AF6215-BP 1mg
EUR 195

TNNI3 Conjugated Antibody
C35662 100ul
EUR 397

TNNI3 Blocking Peptide
AF7807-BP 1mg
EUR 195

TNNI3 (pT142) Antibody
abx012282-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

TNNI3 (pS43) Antibody
abx012283-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

TNNI3 (pS43) Antibody
abx333380-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

TNNI3 (pT142) Antibody
abx333428-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

TNNI3 Rabbit pAb
A0152-100ul 100 ul
EUR 308

TNNI3 Rabbit pAb
A0152-200ul 200 ul
EUR 459

TNNI3 Rabbit pAb
A0152-20ul 20 ul
EUR 183

TNNI3 Rabbit pAb
A0152-50ul 50 ul
EUR 223

TNNI3 Polyclonal Antibody
A53028 100 µg
EUR 570.55
Description: Ask the seller for details

TNNI3 Polyclonal Antibody
A51521 100 µg
EUR 570.55
Description: reagents widely cited

TNNI3 antibody (Thr142)
70R-35706 100 ug
EUR 327
Description: Rabbit polyclonal TNNI3 antibody (Thr142)

TNNI3 Rabbit pAb
A6995-100ul 100 ul
EUR 308

TNNI3 Rabbit pAb
A6995-200ul 200 ul
EUR 459

TNNI3 Rabbit pAb
A6995-20ul 20 ul
EUR 183

TNNI3 Rabbit pAb
A6995-50ul 50 ul
EUR 223

Anti-TNNI3 antibody
STJ72954 100 µg
EUR 359

Anti-TNNI3 antibody
STJ29075 100 µl
EUR 277
Description: Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM).

Anti-TNNI3 antibody
STJ400051 1 mg
EUR 446
Description: Troponins form a complex of three regulatory proteins (troponin C, I and T) that are integral to muscle contraction in skeletal and cardiac muscles. Serum cardiac troponin tests can be used to help diagnose several different heart disorders, especially myocardial infarction.

Anti-TNNI3 antibody
STJ400052 1 mg
EUR 446
Description: Troponins form a complex of three regulatory proteins (troponin C, I and T) that are integral to muscle contraction in skeletal and cardiac muscles. Serum cardiac troponin tests can be used to help diagnose several different heart disorders, especially myocardial infarction.

Anti-TNNI3 antibody
STJ400053 1 mg
EUR 446
Description: Troponins form a complex of three regulatory proteins (troponin C, I and T) that are integral to muscle contraction in skeletal and cardiac muscles. Serum cardiac troponin tests can be used to help diagnose several different heart disorders, especially myocardial infarction.

Anti-TNNI3 antibody
STJ400054 1 mg
EUR 446
Description: Troponins form a complex of three regulatory proteins (troponin C, I and T) that are integral to muscle contraction in skeletal and cardiac muscles. Serum cardiac troponin tests can be used to help diagnose several different heart disorders, especially myocardial infarction.

Anti-TNNI3 antibody
STJ400055 1 mg
EUR 446
Description: Troponins form a complex of three regulatory proteins (troponin C, I and T) that are integral to muscle contraction in skeletal and cardiac muscles. Serum cardiac troponin tests can be used to help diagnose several different heart disorders, especially myocardial infarction.

Anti-TNNI3 antibody
STJ114870 100 µl
EUR 277
Description: Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM).

Active Troponin I Type 3, Cardiac (TNNI3)
4-APA478Hu01
  • EUR 664.48
  • EUR 281.00
  • EUR 2216.80
  • EUR 805.60
  • EUR 1511.20
  • EUR 508.00
  • EUR 5392.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19429
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.4kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Troponin I Type 3, Cardiac expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Recombinant Troponin I Type 3, Cardiac (TNNI3)
4-RPA478Ca01
  • EUR 556.96
  • EUR 252.00
  • EUR 1813.60
  • EUR 671.20
  • EUR 1242.40
  • EUR 436.00
  • EUR 4384.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MKD5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.7kDa
  • Isoelectric Point: 9.7
Description: Recombinant Dog Troponin I Type 3, Cardiac expressed in: E.coli

Recombinant Troponin I Type 3, Cardiac (TNNI3)
4-RPA478Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19429
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.4kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Troponin I Type 3, Cardiac expressed in: E.coli

Recombinant Troponin I Type 3, Cardiac (TNNI3)
4-RPA478Mu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P48787
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: 9.5
Description: Recombinant Mouse Troponin I Type 3, Cardiac expressed in: E.coli

Recombinant Troponin I Type 3, Cardiac (TNNI3)
4-RPA478Po01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A5X497
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Pig Troponin I Type 3, Cardiac expressed in: E.coli

Recombinant Troponin I Type 3, Cardiac (TNNI3)
4-RPA478Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23693
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Troponin I Type 3, Cardiac expressed in: E.coli

cDNA Synthesis SuperMix
20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100
EUR 294

Evo? cDNA Kit
M1164-25
EUR 234

Novo? cDNA Kit
M1165-100
EUR 354

Novo? cDNA Kit
M1165-25
EUR 267

Evo? cDNA Supermix
M1168-100
EUR 381

Evo? cDNA Supermix
M1168-25
EUR 267

Novo? cDNA Supermix
M1169-100
EUR 441

Novo? cDNA Supermix
M1169-25
EUR 289

NATtrol BCID Panel (23 x 0.2mL)
NATBCP-BIO 23 x 0.2mL
EUR 948.56
  • What is the product classification?
  • NATtrol BCID Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Phospho-TNNI3 (Thr142) Antibody
AF3214 200ul
EUR 304
Description: Phospho-TNNI3 (Thr142) Antibody detects endogenous levels of TNNI3 only when phosphorylated at Threonine 142.

Phospho-TNNI3 (Ser43) Antibody
AF3215 200ul
EUR 304
Description: Phospho-TNNI3 (Ser43) Antibody detects endogenous levels of TNNI3 only when phosphorylated at Serine 43.

TNNI3 Cell ELISA Kit
abx595596-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Monoclonal TNNI3 / CTnI Antibody
AMM01758G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human TNNI3 / CTnI. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, E

Anserini TNNI3 ELISA Kit
EAT0498 96Tests
EUR 521

Phospho- TNNI3 (Thr142) Antibody
ABF3214 100 ug
EUR 438

Phospho- TNNI3 (Ser43) Antibody
ABF3215 100 ug
EUR 438

TNNI3 (pS22 / S23) Antibody
20-abx330232
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TNNI3 antibody (Ser22+Ser23)
70R-36027 100 ug
EUR 327
Description: Rabbit polyclonal TNNI3 antibody (Ser22+Ser23)

TNNI3 (Phospho-Thr142) Antibody
12028-100ul 100ul
EUR 252

TNNI3 (Phospho-Thr142) Antibody
12028-50ul 50ul
EUR 187

TNNI3 (Phospho-Ser43) Antibody
12040-100ul 100ul
EUR 252

TNNI3 (Phospho-Ser43) Antibody
12040-50ul 50ul
EUR 187

TNNI3 antibody (Ser23/24)
70R-15072 100 ul
EUR 392
Description: Rabbit polyclonal TNNI3 antibody (Ser23/24)

Phospho-TNNI3 (Thr142) Antibody
CSB-PA948523-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-TNNI3 (Thr142). Recognizes Phospho-TNNI3 (Thr142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-TNNI3 (Thr142) Antibody
CSB-PA948523-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-TNNI3 (Thr142). Recognizes Phospho-TNNI3 (Thr142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Tnni3 Antibody, HRP conjugated
1-CSB-PA341785LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tnni3. Recognizes Tnni3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Tnni3 Antibody, FITC conjugated
1-CSB-PA341785LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tnni3. Recognizes Tnni3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Tnni3 Antibody, Biotin conjugated
1-CSB-PA341785LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tnni3. Recognizes Tnni3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-TNNI3 (Ser43) Antibody
CSB-PA182407-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-TNNI3 (Ser43). Recognizes Phospho-TNNI3 (Ser43) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-TNNI3 (Ser43) Antibody
CSB-PA182407-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-TNNI3 (Ser43). Recognizes Phospho-TNNI3 (Ser43) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TNNI3 Antibody, HRP conjugated
1-CSB-PA07936B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNNI3 Antibody, FITC conjugated
1-CSB-PA07936C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNNI3 Antibody, Biotin conjugated
1-CSB-PA07936D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TNNI3 Antibody, HRP conjugated
1-CSB-PA07937B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNNI3 Antibody, FITC conjugated
1-CSB-PA07937C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNNI3 Antibody, Biotin conjugated
1-CSB-PA07937D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNNI3. Recognizes TNNI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-TNNI3 (T142) Antibody
1-CSB-PA050276
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TNNI3 (T142). Recognizes Phospho-TNNI3 (T142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Phospho-TNNI3 (S43) Antibody
1-CSB-PA050277
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TNNI3 (S43). Recognizes Phospho-TNNI3 (S43) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

TNNI3 Recombinant Protein (Human)
RP044371 100 ug Ask for price

TNNI3 Recombinant Protein (Rat)
RP234152 100 ug Ask for price

TNNI3 Recombinant Protein (Mouse)
RP180371 100 ug Ask for price

Mouse TNNI3 ELISA Kit
STJ150034 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TNNI3/cTn-I in Mouse serum, plasma and other biological fluids

Rat TNNI3 ELISA Kit
STJ150179 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of Tn-I in Rat serum, plasma and other biological fluids

Rat TNNI3 ELISA Kit
STJ150195 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of cTn-I/TNNI3 in Rat serum, plasma and other biological fluids

Human TNNI3 ELISA Kit
STJ150203 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of cTn-I/TNNI3 in human serum, plasma and other biological fluids

TNNI3 cDNA Clone, 0.01mg plasmid +0.2ml

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Blog Theme