Rabbit anti-mouse, Human Ly6e pAb
Rabbit anti-mouse, Human Ly6e pAb
 anti-LY6E |
|
YF-PA12994 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to LY6E |
 anti- LY6E antibody |
|
FNab04895 |
FN Test |
100µg |
EUR 585 |
- Immunogen: lymphocyte antigen 6 complex, locus E
- Uniprot ID: Q16553
- Gene ID: 4061
- Research Area: Stem Cells, Signal Transduction
|
|
Description: Antibody raised against LY6E |
 Anti-LY6E Antibody |
|
A09496-1 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal LY6E Antibody. Validated in IF and tested in Human. |
 Mouse LY6E shRNA Plasmid |
|
20-abx971382 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) LY6E Recombinant Protein (Mouse) |
|
RP148667 |
ABM |
100 ug |
Ask for price |
LY6E Recombinant Protein (Mouse) |
|
RP148670 |
ABM |
100 ug |
Ask for price |
LY6E Recombinant Protein (Mouse) |
|
RP148673 |
ABM |
100 ug |
Ask for price |
LY6E Recombinant Protein (Mouse) |
|
RP148676 |
ABM |
100 ug |
Ask for price |
LY6E Recombinant Protein (Mouse) |
|
RP148679 |
ABM |
100 ug |
Ask for price |
LY6E Recombinant Protein (Mouse) |
|
RP148682 |
ABM |
100 ug |
Ask for price |
 LY6E siRNA |
|
20-abx923134 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LY6E siRNA |
|
20-abx923135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 LY6E antibody |
|
70R-35979 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal LY6E antibody |
 LY6E Antibody |
|
34769-100ul |
SAB |
100ul |
EUR 252 |
LY6E Antibody |
|
34769-50ul |
SAB |
50ul |
EUR 187 |
LY6E Antibody |
|
1-CSB-PA619076LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 Ly6e Antibody |
|
1-CSB-PA717533LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
LY6E Antibody |
|
1-CSB-PA009885 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000 |
 Human LY6E shRNA Plasmid |
|
20-abx952750 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) LY6E Recombinant Protein (Human) |
|
RP041170 |
ABM |
100 ug |
Ask for price |
 pAb rabbit anti-human EPO |
|
CT282 |
U-CyTech |
0.5 mg |
EUR 184 |
) Mouse Lymphocyte antigen 6E (Ly6e) |
|
1-CSB-YP717533MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 24.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in Yeast |
Mouse Lymphocyte antigen 6E (Ly6e) |
|
1-CSB-EP717533MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 22.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli |
Mouse Lymphocyte antigen 6E (Ly6e) |
|
1-CSB-EP717533MOb1 |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 13.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli |
 (pORF)) Ly6e ORF Vector (Mouse) (pORF) |
|
ORF049557 |
ABM |
1.0 ug DNA |
EUR 506 |
Ly6e ORF Vector (Mouse) (pORF) |
|
ORF049558 |
ABM |
1.0 ug DNA |
EUR 506 |
Ly6e ORF Vector (Mouse) (pORF) |
|
ORF049559 |
ABM |
1.0 ug DNA |
EUR 506 |
Ly6e ORF Vector (Mouse) (pORF) |
|
ORF049560 |
ABM |
1.0 ug DNA |
EUR 506 |
Ly6e ORF Vector (Mouse) (pORF) |
|
ORF049561 |
ABM |
1.0 ug DNA |
EUR 506 |
Ly6e ORF Vector (Mouse) (pORF) |
|
ORF049562 |
ABM |
1.0 ug DNA |
EUR 506 |
 pAb rabbit anti-mouse TNF-α |
|
CT315 |
U-CyTech |
0.5 mg |
EUR 184 |
 pAb rabbit anti-mouse IFN-γ |
|
CT333 |
U-CyTech |
0.5 mg |
EUR 184 |
 Polyclonal Goat anti-GST α-form |
|
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
 Polyclonal Goat anti-GST μ-form |
|
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
 Polyclonal Goat anti-GST p-form |
|
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
 LY6E Conjugated Antibody |
|
C34769 |
SAB |
100ul |
EUR 397 |
 Ly6e Polyclonal Antibody |
|
A59690 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 LY6E Polyclonal Antibody |
|
A50917 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 LY6E cloning plasmid |
|
CSB-CL619076HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 396
- Sequence: ATGAAGATCTTCTTGCCAGTGCTGCTGGCTGCCCTTCTGGGTGTGGAGCGAGCCAGCTCGCTGATGTGCTTCTCCTGCTTGAACCAGAAGAGCAATCTGTACTGCCTGAAGCCGACCATCTGCTCCGACCAGGACAACTACTGCGTGACTGTGTCTGCTAGTGCCGGCATTGGGAA
- Show more
|
|
Description: A cloning plasmid for the LY6E gene. |
 Anti-LY6E-Mc-VC-PABC-MMAE ADC |
|
ADC-W-305 |
Creative Biolabs |
1mg |
Ask for price |
|
Description: This ADC product is comprised of an anti-LY6E monoclonal antibody conjugated via a Mc-VC-PABC linker to MMAE |
 Rabbit anti-LukA pAb |
|
0316-001 |
IBT Bioservices |
100ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
 Rabbit anti-LukB pAb |
|
0317-001 |
IBT Bioservices |
100ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
 Rabbit anti-Junin pAb |
|
04-0006 |
IBT Bioservices |
500ug |
EUR 257 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
 Rabbit anti-Hla pAb |
|
04-0010 |
IBT Bioservices |
500ug |
EUR 303 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
) Human Lymphocyte antigen 6E (LY6E) |
|
1-CSB-EP619076HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 24.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Lymphocyte antigen 6E(LY6E) expressed in E.coli |
 (pORF)) LY6E ORF Vector (Human) (pORF) |
|
ORF013724 |
ABM |
1.0 ug DNA |
EUR 354 |
 (OKCA02062)) LY6E ELISA Kit (Human) (OKCA02062) |
|
OKCA02062 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL |
 pAb rabbit anti-human IFN-γ |
|
CT217 |
U-CyTech |
0.5 mg |
EUR 184 |
pAb rabbit anti-human IFN-γ |
|
CT219 |
U-CyTech |
0.5 mg |
EUR 443 |
 pAb rabbit anti-human IL-13 |
|
CT226 |
U-CyTech |
0.5 mg |
EUR 184 |
 pAb rabbit anti-human IL-2 |
|
CT261 |
U-CyTech |
0.5 mg |
EUR 260 |
 pAb rabbit anti-human IL-10 |
|
CT267 |
U-CyTech |
0.5 mg |
EUR 184 |
 pAb rabbit anti-human IL-12p70 |
|
CT273 |
U-CyTech |
0.5 mg |
EUR 207 |
 pAb rabbit anti-human G-CSF |
|
CT278 |
U-CyTech |
0.5 mg |
EUR 184 |
) Ly6e sgRNA CRISPR Lentivector set (Mouse) |
|
K4719801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 LY6E Antibody, HRP conjugated |
|
1-CSB-PA619076LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 LY6E Antibody, FITC conjugated |
|
1-CSB-PA619076LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 LY6E Antibody, Biotin conjugated |
|
1-CSB-PA619076LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Ly6e Antibody, HRP conjugated |
|
1-CSB-PA717533LB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
 Ly6e Antibody, FITC conjugated |
|
1-CSB-PA717533LC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
 Ly6e Antibody, Biotin conjugated |
|
1-CSB-PA717533LD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
) LY6E Recombinant Protein (Rat) |
|
RP210353 |
ABM |
100 ug |
Ask for price |
) LY6E sgRNA CRISPR Lentivector set (Human) |
|
K1245101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Rabbit anti DDDDK-Tag pAb |
|
AE004 |
Abclonal |
50 ul |
EUR 195 |
 Rabbit anti GST-Tag pAb |
|
AE006 |
Abclonal |
100 ul |
EUR 195 |
 Rabbit anti GFP-Tag pAb |
|
AE011 |
Abclonal |
50 ul |
EUR 176 |
 Rabbit anti V5-Tag pAb |
|
AE022 |
Abclonal |
50 ul |
EUR 256 |
 Rabbit anti HA-Tag pAb |
|
AE036 |
Abclonal |
100 ul |
EUR 308 |
 Rabbit anti His-Tag pAb |
|
AE068 |
Abclonal |
50 ul |
EUR 195 |
 anti-HCV NS5a rabbit pAb |
|
199-A-01mg |
Virogen |
0,1 mg |
EUR 267.5 |
- Category: Antibody, Viral antibodies, rAb
|
|
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein |
anti-HCV NS5a rabbit pAb |
|
199-A-1000ug |
Virogen |
1000 ug |
EUR 1282.5 |
- Category: Antibody, Viral antibodies, rAb
|
|
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein |
 Rabbit anti-EBOV VP40 pAb |
|
0301-010 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-EBOV NP pAb |
|
0301-012 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-EBOV GP pAb |
|
0301-015 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-EBOV VP35 pAb |
|
0301-040 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-EBOV VP24 pAb |
|
0301-046 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
Rabbit anti-EBOV VP24 pAb |
|
0301-047 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-EBOV VP30 pAb |
|
0301-048 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-SUDV VP40 pAb |
|
0302-001 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-SUDV NP pAb |
|
0302-012 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-SUDV GP pAb |
|
0302-020 |
IBT Bioservices |
500ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-SUDV sGP pAb |
|
0302-030 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-MARV VP40 pAb |
|
0303-001 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-MARV GP pAb |
|
0303-007 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
Rabbit anti-MARV GP pAb |
|
0303-007-bio |
IBT Bioservices |
100ug |
EUR 608 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-MARV NP pAb |
|
0303-012 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-BDBV GP pAb |
|
0304-001 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-RESTV GP pAb |
|
0305-001 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-CHIKV E2 pAb |
|
0306-001 |
IBT Bioservices |
100ug |
EUR 506 |
Description: - Related to: Alphaviruses
- Applications: ELISA, WB
|
 Rabbit anti-LASV GP pAb |
|
0307-001 |
IBT Bioservices |
100ug |
EUR 476 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
 Rabbit anti-LASV V pAb |
|
0307-002 |
IBT Bioservices |
100ug |
EUR 476 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
 Rabbit anti-ZIKA GP pAb |
|
0308-001 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
 Rabbit anti-ZIKA NS1 pAb |
|
0308-002 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
 Rabbit anti-LukF-PV pAb |
|
0312-002 |
IBT Bioservices |
500ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
) Rabbit anti-LukAB pAb (neutralizing) |
|
0313-001 |
IBT Bioservices |
500ug |
EUR 405 |
Description: - Related to: Staphylococcus
- Applications: Neutralization
|
 Rabbit anti-Hlg B pAb |
|
0314-001 |
IBT Bioservices |
500ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
 Rabbit anti-Hlg C pAb |
|
0314-002 |
IBT Bioservices |
500ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
 Rabbit anti-EBOV VLP pAb |
|
0315-001 |
IBT Bioservices |
500ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 Rabbit anti-MARV VLP pAb |
|
04-0005 |
IBT Bioservices |
500ug |
EUR 253 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
 pAb) Rabbit anti-Chikungunya (CHIKV) pAb |
|
04-0008 |
IBT Bioservices |
500ug |
EUR 293 |
Description: - Related to: Alphaviruses
- Applications: ELISA, WB
|
 Rabbit anti-LukS-PV pAb |
|
04-0009 |
IBT Bioservices |
500ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
 anti-HCV NS5b rabbit pAb |
|
266-A-01mg |
Virogen |
0,1 mg |
EUR 267.5 |
- Category: Antibody, Viral antibodies, rAb
|
|
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein |
anti-HCV NS5b rabbit pAb |
|
266-A-1000ug |
Virogen |
1000 ug |
EUR 1282.5 |
- Category: Antibody, Viral antibodies, rAb
|
|
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein |
 pAb rabbit anti-human IL-4 receptor |
|
CT248 |
U-CyTech |
0.5 mg |
EUR 184 |
 Mouse Lymphocyte antigen 6E, Ly6e ELISA KIT |
|
ELI-39137m |
Lifescience Market |
96 Tests |
EUR 865 |
 (Target 1)) Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4719802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4719803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4719804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) LY6E Protein Vector (Mouse) (pPB-C-His) |
|
PV198226 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) LY6E Protein Vector (Mouse) (pPB-N-His) |
|
PV198227 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) LY6E Protein Vector (Mouse) (pPM-C-HA) |
|
PV198228 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) LY6E Protein Vector (Mouse) (pPM-C-His) |
|
PV198229 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-C-His) |
|
PV198230 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-N-His) |
|
PV198231 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-HA) |
|
PV198232 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-His) |
|
PV198233 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-C-His) |
|
PV198234 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-N-His) |
|
PV198235 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-HA) |
|
PV198236 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-His) |
|
PV198237 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-C-His) |
|
PV198238 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-N-His) |
|
PV198239 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-HA) |
|
PV198240 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-His) |
|
PV198241 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-C-His) |
|
PV198242 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-N-His) |
|
PV198243 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-HA) |
|
PV198244 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-His) |
|
PV198245 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-C-His) |
|
PV198246 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPB-N-His) |
|
PV198247 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-HA) |
|
PV198248 |
ABM |
500 ng |
EUR 603 |
LY6E Protein Vector (Mouse) (pPM-C-His) |
|
PV198249 |
ABM |
500 ng |
EUR 603 |
 pAb rabbit anti-mouse TNF-α Biotin labeled |
|
CT332 |
U-CyTech |
0.5 mg |
EUR 347 |
 Anti-E.coli HCP |
|
F117-PAB |
Cygnus Technologies |
1 ml |
EUR 912 |
- Product category: Antibodies
|
|
Description: Anti-E.coli HCP by Cygnus Technologies is available in Europe via Gentaur. |
 Polyclonal Antibody) Anti-recombinant human MetAP-2 (full-length) Polyclonal Antibody |
|
PAB-503208 |
Mediomics |
1 viaL |
EUR 352 |
 Ly6e Polyclonal Antibody, Biotin Conjugated |
|
A59691 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 Ly6e Polyclonal Antibody, FITC Conjugated |
|
A59692 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 Ly6e Polyclonal Antibody, HRP Conjugated |
|
A59693 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 LY6E Polyclonal Antibody, HRP Conjugated |
|
A50918 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 LY6E Polyclonal Antibody, FITC Conjugated |
|
A50919 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 LY6E Polyclonal Antibody, Biotin Conjugated |
|
A50920 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 (pORF)) Ly6e ORF Vector (Rat) (pORF) |
|
ORF070119 |
ABM |
1.0 ug DNA |
EUR 506 |
 Human Lymphocyte antigen 6E, LY6E ELISA KIT |
|
ELI-27779h |
Lifescience Market |
96 Tests |
EUR 824 |
 (Target 1)) LY6E sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1245102 |
ABM |
1.0 ug DNA |
EUR 154 |
Rabbit anti-mouse, Human Ly6e pAb
 antibody)
