Rabbit anti-mouse, Human Ly6e pAb

Rabbit anti-mouse, Human Ly6e pAb 

To Order Contact us: caitlyn@ucb-bioproducts.com

anti-LY6E

YF-PA12994 100 ug
EUR 403
Description: Rabbit polyclonal to LY6E

Anti-LY6E (mouse) antibody

STJ72310 100 µg
EUR 359

anti- LY6E antibody

FNab04895 100µg
EUR 585
  • Immunogen: lymphocyte antigen 6 complex, locus E
  • Uniprot ID: Q16553
  • Gene ID: 4061
  • Research Area: Stem Cells, Signal Transduction
Description: Antibody raised against LY6E

Anti-LY6E Antibody

A09496-1 100ul
EUR 397
Description: Rabbit Polyclonal LY6E Antibody. Validated in IF and tested in Human.

Anti-LY6E antibody

PAab04895 100 ug
EUR 412

Anti-LY6E antibody

STJ112263 100 µl
EUR 277

Mouse LY6E shRNA Plasmid

20-abx971382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY6E Recombinant Protein (Mouse)

RP148667 100 ug Ask for price

LY6E Recombinant Protein (Mouse)

RP148670 100 ug Ask for price

LY6E Recombinant Protein (Mouse)

RP148673 100 ug Ask for price

LY6E Recombinant Protein (Mouse)

RP148676 100 ug Ask for price

LY6E Recombinant Protein (Mouse)

RP148679 100 ug Ask for price

LY6E Recombinant Protein (Mouse)

RP148682 100 ug Ask for price

LY6E siRNA

20-abx923134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY6E siRNA

20-abx923135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY6E antibody

70R-35979 100 ug
EUR 327
Description: Rabbit polyclonal LY6E antibody

LY6E Antibody

34769-100ul 100ul
EUR 252

LY6E Antibody

34769-50ul 50ul
EUR 187

LY6E Antibody

1-CSB-PA619076LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Ly6e Antibody

1-CSB-PA717533LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

LY6E Antibody

1-CSB-PA009885
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

LY6E ELISA KIT|Human

EF010756 96 Tests
EUR 689

Human LY6E shRNA Plasmid

20-abx952750
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY6E Recombinant Protein (Human)

RP041170 100 ug Ask for price

pAb rabbit anti-human EPO

CT282 0.5 mg
EUR 184

Mouse Lymphocyte antigen 6E (Ly6e)

1-CSB-YP717533MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in Yeast

Mouse Lymphocyte antigen 6E (Ly6e)

1-CSB-EP717533MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli

Mouse Lymphocyte antigen 6E (Ly6e)

1-CSB-EP717533MOb1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 13.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli

Ly6e ORF Vector (Mouse) (pORF)

ORF049557 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)

ORF049558 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)

ORF049559 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)

ORF049560 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)

ORF049561 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)

ORF049562 1.0 ug DNA
EUR 506

pAb rabbit anti-mouse TNF-α

CT315 0.5 mg
EUR 184

pAb rabbit anti-mouse IFN-γ

CT333 0.5 mg
EUR 184

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

LY6E Conjugated Antibody

C34769 100ul
EUR 397

Ly6e Polyclonal Antibody

A59690 100 µg
EUR 570.55
Description: The best epigenetics products

LY6E Polyclonal Antibody

A50917 100 µg
EUR 570.55
Description: Ask the seller for details

LY6E cloning plasmid

CSB-CL619076HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 396
  • Sequence: ATGAAGATCTTCTTGCCAGTGCTGCTGGCTGCCCTTCTGGGTGTGGAGCGAGCCAGCTCGCTGATGTGCTTCTCCTGCTTGAACCAGAAGAGCAATCTGTACTGCCTGAAGCCGACCATCTGCTCCGACCAGGACAACTACTGCGTGACTGTGTCTGCTAGTGCCGGCATTGGGAA
  • Show more
Description: A cloning plasmid for the LY6E gene.

Anti-LY6E-Mc-VC-PABC-MMAE ADC

ADC-W-305 1mg Ask for price
Description: This ADC product is comprised of an anti-LY6E monoclonal antibody conjugated via a Mc-VC-PABC linker to MMAE

Rabbit anti-LukA pAb

0316-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-LukB pAb

0317-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-Junin pAb

04-0006 500ug
EUR 257
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-Hla pAb

04-0010 500ug
EUR 303
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Human Lymphocyte antigen 6E (LY6E)

1-CSB-EP619076HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lymphocyte antigen 6E(LY6E) expressed in E.coli

LY6E ORF Vector (Human) (pORF)

ORF013724 1.0 ug DNA
EUR 354

LY6E ELISA Kit (Human) (OKCA02062)

OKCA02062 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL

pAb rabbit anti-human IFN-γ

CT217 0.5 mg
EUR 184

pAb rabbit anti-human IFN-γ

CT219 0.5 mg
EUR 443

pAb rabbit anti-human IL-13

CT226 0.5 mg
EUR 184

pAb rabbit anti-human IL-2

CT261 0.5 mg
EUR 260

pAb rabbit anti-human IL-10

CT267 0.5 mg
EUR 184

pAb rabbit anti-human IL-12p70

CT273 0.5 mg
EUR 207

pAb rabbit anti-human G-CSF

CT278 0.5 mg
EUR 184

Ly6e sgRNA CRISPR Lentivector set (Mouse)

K4719801 3 x 1.0 ug
EUR 339

LY6E Antibody, HRP conjugated

1-CSB-PA619076LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY6E Antibody, FITC conjugated

1-CSB-PA619076LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY6E Antibody, Biotin conjugated

1-CSB-PA619076LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ly6e Antibody, HRP conjugated

1-CSB-PA717533LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ly6e Antibody, FITC conjugated

1-CSB-PA717533LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ly6e Antibody, Biotin conjugated

1-CSB-PA717533LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

LY6E Recombinant Protein (Rat)

RP210353 100 ug Ask for price

LY6E sgRNA CRISPR Lentivector set (Human)

K1245101 3 x 1.0 ug
EUR 339

Rabbit anti DDDDK-Tag pAb

AE004 50 ul
EUR 195

Rabbit anti GST-Tag pAb

AE006 100 ul
EUR 195

Rabbit anti GFP-Tag pAb

AE011 50 ul
EUR 176

Rabbit anti V5-Tag pAb

AE022 50 ul
EUR 256

Rabbit anti HA-Tag pAb

AE036 100 ul
EUR 308

Rabbit anti His-Tag pAb

AE068 50 ul
EUR 195

anti-HCV NS5a rabbit pAb

199-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

anti-HCV NS5a rabbit pAb

199-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

Rabbit anti-EBOV VP40 pAb

0301-010 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV NP pAb

0301-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV GP pAb

0301-015 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP35 pAb

0301-040 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb

0301-046 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb

0301-047 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP30 pAb

0301-048 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV VP40 pAb

0302-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV NP pAb

0302-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV GP pAb

0302-020 500ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV sGP pAb

0302-030 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV VP40 pAb

0303-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV GP pAb

0303-007 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV GP pAb

0303-007-bio 100ug
EUR 608
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV NP pAb

0303-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-BDBV GP pAb

0304-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-RESTV GP pAb

0305-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-CHIKV E2 pAb

0306-001 100ug
EUR 506
Description:
  • Related to: Alphaviruses
  • Applications: ELISA, WB

Rabbit anti-LASV GP pAb

0307-001 100ug
EUR 476
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-LASV V pAb

0307-002 100ug
EUR 476
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-ZIKA GP pAb

0308-001 100ug
EUR 481
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-ZIKA NS1 pAb

0308-002 100ug
EUR 481
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-LukF-PV pAb

0312-002 500ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-LukAB pAb (neutralizing)

0313-001 500ug
EUR 405
Description:
  • Related to: Staphylococcus
  • Applications: Neutralization

Rabbit anti-Hlg B pAb

0314-001 500ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-Hlg C pAb

0314-002 500ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-EBOV VLP pAb

0315-001 500ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV VLP pAb

04-0005 500ug
EUR 253
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-Chikungunya (CHIKV) pAb

04-0008 500ug
EUR 293
Description:
  • Related to: Alphaviruses
  • Applications: ELISA, WB

Rabbit anti-LukS-PV pAb

04-0009 500ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

anti-HCV NS5b rabbit pAb

266-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5b rabbit pAb

266-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

pAb rabbit anti-human IL-4 receptor

CT248 0.5 mg
EUR 184

Mouse Lymphocyte antigen 6E, Ly6e ELISA KIT

ELI-39137m 96 Tests
EUR 865

Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4719802 1.0 ug DNA
EUR 154

Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4719803 1.0 ug DNA
EUR 154

Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4719804 1.0 ug DNA
EUR 154

LY6E Protein Vector (Mouse) (pPB-C-His)

PV198226 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)

PV198227 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)

PV198228 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)

PV198229 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)

PV198230 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)

PV198231 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)

PV198232 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)

PV198233 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)

PV198234 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)

PV198235 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)

PV198236 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)

PV198237 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)

PV198238 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)

PV198239 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)

PV198240 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)

PV198241 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)

PV198242 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)

PV198243 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)

PV198244 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)

PV198245 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)

PV198246 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)

PV198247 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)

PV198248 500 ng
EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)

PV198249 500 ng
EUR 603

pAb rabbit anti-mouse TNF-α Biotin labeled

CT332 0.5 mg
EUR 347

Anti-E.coli HCP

F117-PAB 1 ml
EUR 912
  • Product category: Antibodies
Description: Anti-E.coli HCP by Cygnus Technologies is available in Europe via Gentaur.

Anti-recombinant human MetAP-2 (full-length) Polyclonal Antibody

PAB-503208 1 viaL
EUR 352

Ly6e Polyclonal Antibody, Biotin Conjugated

A59691 100 µg
EUR 570.55
Description: kits suitable for this type of research

Ly6e Polyclonal Antibody, FITC Conjugated

A59692 100 µg
EUR 570.55
Description: fast delivery possible

Ly6e Polyclonal Antibody, HRP Conjugated

A59693 100 µg
EUR 570.55
Description: reagents widely cited

LY6E Polyclonal Antibody, HRP Conjugated

A50918 100 µg
EUR 570.55
Description: The best epigenetics products

LY6E Polyclonal Antibody, FITC Conjugated

A50919 100 µg
EUR 570.55
Description: kits suitable for this type of research

LY6E Polyclonal Antibody, Biotin Conjugated

A50920 100 µg
EUR 570.55
Description: fast delivery possible

Ly6e ORF Vector (Rat) (pORF)

ORF070119 1.0 ug DNA
EUR 506

Human Lymphocyte antigen 6E, LY6E ELISA KIT

ELI-27779h 96 Tests
EUR 824

LY6E sgRNA CRISPR Lentivector (Human) (Target 1)

K1245102 1.0 ug DNA
EUR 154

Rabbit anti-mouse, Human Ly6e pAb