Rabbit anti-mouse, Human Ly6e pAb

Rabbit anti-mouse, Human Ly6e pAb 

To Order Contact us: caitlyn@ucb-bioproducts.com

anti-LY6E
YF-PA12994 100 ug
EUR 403
Description: Rabbit polyclonal to LY6E

Anti-LY6E (mouse) antibody
STJ72310 100 µg
EUR 359

Anti-LY6E Antibody
A09496-1 100ul
EUR 397
Description: Rabbit Polyclonal LY6E Antibody. Validated in IF and tested in Human.

anti- LY6E antibody
FNab04895 100µg
EUR 585
  • Immunogen: lymphocyte antigen 6 complex, locus E
  • Uniprot ID: Q16553
  • Gene ID: 4061
  • Research Area: Stem Cells, Signal Transduction
Description: Antibody raised against LY6E

Anti-LY6E antibody
PAab04895 100 ug
EUR 412

Anti-LY6E antibody
STJ112263 100 µl
EUR 277

Mouse LY6E shRNA Plasmid
20-abx971382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY6E Recombinant Protein (Mouse)
RP148667 100 ug Ask for price

LY6E Recombinant Protein (Mouse)
RP148670 100 ug Ask for price

LY6E Recombinant Protein (Mouse)
RP148673 100 ug Ask for price

LY6E Recombinant Protein (Mouse)
RP148676 100 ug Ask for price

LY6E Recombinant Protein (Mouse)
RP148679 100 ug Ask for price

LY6E Recombinant Protein (Mouse)
RP148682 100 ug Ask for price

LY6E Antibody
34769-100ul 100ul
EUR 252

LY6E Antibody
34769-50ul 50ul
EUR 187

LY6E Antibody
1-CSB-PA619076LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Ly6e Antibody
1-CSB-PA717533LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

LY6E antibody
70R-35979 100 ug
EUR 327
Description: Rabbit polyclonal LY6E antibody

LY6E Antibody
1-CSB-PA009885
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

LY6E siRNA
20-abx923134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY6E siRNA
20-abx923135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY6E ELISA KIT|Human
EF010756 96 Tests
EUR 689

Human LY6E shRNA Plasmid
20-abx952750
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY6E Recombinant Protein (Human)
RP041170 100 ug Ask for price

pAb rabbit anti-human EPO
CT282 0.5 mg
EUR 184

Mouse Lymphocyte antigen 6E (Ly6e)
1-CSB-EP717533MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli

Mouse Lymphocyte antigen 6E (Ly6e)
1-CSB-EP717533MOb1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 13.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli

Mouse Lymphocyte antigen 6E (Ly6e)
1-CSB-YP717533MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in Yeast

Ly6e ORF Vector (Mouse) (pORF)
ORF049557 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049558 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049559 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049560 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049561 1.0 ug DNA
EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049562 1.0 ug DNA
EUR 506

pAb rabbit anti-mouse TNF-α
CT315 0.5 mg
EUR 184

pAb rabbit anti-mouse IFN-γ
CT333 0.5 mg
EUR 184

Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280

LY6E Conjugated Antibody
C34769 100ul
EUR 397

LY6E cloning plasmid
CSB-CL619076HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 396
  • Sequence: ATGAAGATCTTCTTGCCAGTGCTGCTGGCTGCCCTTCTGGGTGTGGAGCGAGCCAGCTCGCTGATGTGCTTCTCCTGCTTGAACCAGAAGAGCAATCTGTACTGCCTGAAGCCGACCATCTGCTCCGACCAGGACAACTACTGCGTGACTGTGTCTGCTAGTGCCGGCATTGGGAA
  • Show more
Description: A cloning plasmid for the LY6E gene.

Ly6e Polyclonal Antibody
A59690 100 µg
EUR 570.55
Description: The best epigenetics products

LY6E Polyclonal Antibody
A50917 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-LY6E-Mc-VC-PABC-MMAE ADC
ADC-W-305 1mg Ask for price
Description: This ADC product is comprised of an anti-LY6E monoclonal antibody conjugated via a Mc-VC-PABC linker to MMAE

Rabbit anti-LukA pAb
0316-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-LukB pAb
0317-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-Junin pAb
04-0006 500ug
EUR 257
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-Hla pAb
04-0010 500ug
EUR 303
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Human Lymphocyte antigen 6E (LY6E)
1-CSB-EP619076HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lymphocyte antigen 6E(LY6E) expressed in E.coli

LY6E ORF Vector (Human) (pORF)
ORF013724 1.0 ug DNA
EUR 354

LY6E ELISA Kit (Human) (OKCA02062)
OKCA02062 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL

pAb rabbit anti-human IFN-γ
CT217 0.5 mg
EUR 184

pAb rabbit anti-human IFN-γ
CT219 0.5 mg
EUR 443

pAb rabbit anti-human IL-13
CT226 0.5 mg
EUR 184

pAb rabbit anti-human IL-2
CT261 0.5 mg
EUR 260

pAb rabbit anti-human IL-10
CT267 0.5 mg
EUR 184

pAb rabbit anti-human IL-12p70
CT273 0.5 mg
EUR 207

pAb rabbit anti-human G-CSF
CT278 0.5 mg
EUR 184

Ly6e sgRNA CRISPR Lentivector set (Mouse)
K4719801 3 x 1.0 ug
EUR 339

LY6E Antibody, HRP conjugated
1-CSB-PA619076LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY6E Antibody, FITC conjugated
1-CSB-PA619076LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY6E Antibody, Biotin conjugated
1-CSB-PA619076LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ly6e Antibody, HRP conjugated
1-CSB-PA717533LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ly6e Antibody, FITC conjugated
1-CSB-PA717533LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ly6e Antibody, Biotin conjugated
1-CSB-PA717533LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

LY6E Recombinant Protein (Rat)
RP210353 100 ug Ask for price

LY6E sgRNA CRISPR Lentivector set (Human)
K1245101 3 x 1.0 ug
EUR 339

anti-HCV NS5b rabbit pAb
266-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5b rabbit pAb
266-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5a rabbit pAb
199-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

anti-HCV NS5a rabbit pAb
199-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

Rabbit anti-EBOV VP40 pAb
0301-010 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV NP pAb
0301-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV GP pAb
0301-015 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP35 pAb
0301-040 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb
0301-046 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb
0301-047 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP30 pAb
0301-048 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV VP40 pAb
0302-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV NP pAb
0302-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV GP pAb
0302-020 500ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV sGP pAb
0302-030 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV VP40 pAb
0303-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV GP pAb
0303-007 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV GP pAb
0303-007-bio 100ug
EUR 608
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-MARV NP pAb
0303-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-BDBV GP pAb
0304-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-RESTV GP pAb
0305-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-CHIKV E2 pAb
0306-001 100ug
EUR 506
Description:
  • Related to: Alphaviruses
  • Applications: ELISA, WB

Rabbit anti-LASV GP pAb
0307-001 100ug
EUR 476
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-LASV V pAb
0307-002 100ug
EUR 476
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-ZIKA GP pAb
0308-001 100ug
EUR 481
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-ZIKA NS1 pAb
0308-002 100ug
EUR 481
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-LukF-PV pAb
0312-002 500ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-LukAB pAb (neutralizing)
0313-001 500ug
EUR 405
Description:
  • Related to: Staphylococcus
  • Applications: Neutralization

Rabbit anti-mouse, Human Ly6e pAb

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Blog Theme