Rabbit anti-mouse, Human Ly6e pAb

Rabbit anti-mouse, Human Ly6e pAb 

To Order Contact us: caitlyn@ucb-bioproducts.com

anti-LY6E
YF-PA12994	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to LY6E

Anti-LY6E (mouse) antibody
STJ72310	St John's Laboratory	100 µg	EUR 359

Anti-LY6E Antibody
A09496-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal LY6E Antibody. Validated in IF and tested in Human.

anti- LY6E antibody
FNab04895	FN Test	100µg	EUR 585
Immunogen: lymphocyte antigen 6 complex, locus E Uniprot ID: Q16553 Gene ID: 4061 Research Area: Stem Cells, Signal Transduction
Description: Antibody raised against LY6E

Anti-LY6E antibody
PAab04895	Lifescience Market	100 ug	EUR 412

Anti-LY6E antibody
STJ112263	St John's Laboratory	100 µl	EUR 277

Mouse LY6E shRNA Plasmid
20-abx971382	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY6E Recombinant Protein (Mouse)
RP148667	ABM	100 ug	Ask for price

LY6E Recombinant Protein (Mouse)
RP148670	ABM	100 ug	Ask for price

LY6E Recombinant Protein (Mouse)
RP148673	ABM	100 ug	Ask for price

LY6E Recombinant Protein (Mouse)
RP148676	ABM	100 ug	Ask for price

LY6E Recombinant Protein (Mouse)
RP148679	ABM	100 ug	Ask for price

LY6E Recombinant Protein (Mouse)
RP148682	ABM	100 ug	Ask for price

LY6E Antibody
34769-100ul	SAB	100ul	EUR 252

LY6E Antibody
34769-50ul	SAB	50ul	EUR 187

LY6E Antibody
1-CSB-PA619076LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Ly6e Antibody
1-CSB-PA717533LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

LY6E antibody
70R-35979	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal LY6E antibody

LY6E Antibody
1-CSB-PA009885	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

LY6E siRNA
20-abx923134	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY6E siRNA
20-abx923135	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY6E ELISA KIT|Human
EF010756	Lifescience Market	96 Tests	EUR 689

Human LY6E shRNA Plasmid
20-abx952750	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY6E Recombinant Protein (Human)
RP041170	ABM	100 ug	Ask for price

pAb rabbit anti-human EPO
CT282	U-CyTech	0.5 mg	EUR 184

Mouse Lymphocyte antigen 6E (Ly6e)
1-CSB-EP717533MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 22.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli

Mouse Lymphocyte antigen 6E (Ly6e)
1-CSB-EP717533MOb1	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 13.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in E.coli

Mouse Lymphocyte antigen 6E (Ly6e)
1-CSB-YP717533MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 24.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 6E(Ly6e) expressed in Yeast

Ly6e ORF Vector (Mouse) (pORF)
ORF049557	ABM	1.0 ug DNA	EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049558	ABM	1.0 ug DNA	EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049559	ABM	1.0 ug DNA	EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049560	ABM	1.0 ug DNA	EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049561	ABM	1.0 ug DNA	EUR 506

Ly6e ORF Vector (Mouse) (pORF)
ORF049562	ABM	1.0 ug DNA	EUR 506

pAb rabbit anti-mouse TNF-α
CT315	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-mouse IFN-γ
CT333	U-CyTech	0.5 mg	EUR 184

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

LY6E Conjugated Antibody
C34769	SAB	100ul	EUR 397

LY6E cloning plasmid
CSB-CL619076HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 396 Sequence: ATGAAGATCTTCTTGCCAGTGCTGCTGGCTGCCCTTCTGGGTGTGGAGCGAGCCAGCTCGCTGATGTGCTTCTCCTGCTTGAACCAGAAGAGCAATCTGTACTGCCTGAAGCCGACCATCTGCTCCGACCAGGACAACTACTGCGTGACTGTGTCTGCTAGTGCCGGCATTGGGAA Show more
Description: A cloning plasmid for the LY6E gene.

Ly6e Polyclonal Antibody
A59690	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

LY6E Polyclonal Antibody
A50917	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Anti-LY6E-Mc-VC-PABC-MMAE ADC
ADC-W-305	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-LY6E monoclonal antibody conjugated via a Mc-VC-PABC linker to MMAE

Rabbit anti-LukA pAb
0316-001	IBT Bioservices	100ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-LukB pAb
0317-001	IBT Bioservices	100ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-Junin pAb
04-0006	IBT Bioservices	500ug	EUR 257
Description: Related to: Other Viruses Applications: ELISA, WB

Rabbit anti-Hla pAb
04-0010	IBT Bioservices	500ug	EUR 303
Description: Related to: Staphylococcus Applications: ELISA, WB

Human Lymphocyte antigen 6E (LY6E)
1-CSB-EP619076HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 24.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lymphocyte antigen 6E(LY6E) expressed in E.coli

LY6E ORF Vector (Human) (pORF)
ORF013724	ABM	1.0 ug DNA	EUR 354

LY6E ELISA Kit (Human) (OKCA02062)
OKCA02062	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL

pAb rabbit anti-human IFN-γ
CT217	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-human IFN-γ
CT219	U-CyTech	0.5 mg	EUR 443

pAb rabbit anti-human IL-13
CT226	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-human IL-2
CT261	U-CyTech	0.5 mg	EUR 260

pAb rabbit anti-human IL-10
CT267	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-human IL-12p70
CT273	U-CyTech	0.5 mg	EUR 207

pAb rabbit anti-human G-CSF
CT278	U-CyTech	0.5 mg	EUR 184

Ly6e sgRNA CRISPR Lentivector set (Mouse)
K4719801	ABM	3 x 1.0 ug	EUR 339

LY6E Antibody, HRP conjugated
1-CSB-PA619076LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY6E Antibody, FITC conjugated
1-CSB-PA619076LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY6E Antibody, Biotin conjugated
1-CSB-PA619076LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6E. Recognizes LY6E from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ly6e Antibody, HRP conjugated
1-CSB-PA717533LB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ly6e Antibody, FITC conjugated
1-CSB-PA717533LC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ly6e Antibody, Biotin conjugated
1-CSB-PA717533LD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ly6e. Recognizes Ly6e from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

LY6E Recombinant Protein (Rat)
RP210353	ABM	100 ug	Ask for price

LY6E sgRNA CRISPR Lentivector set (Human)
K1245101	ABM	3 x 1.0 ug	EUR 339

anti-HCV NS5b rabbit pAb
266-A-01mg	Virogen	0,1 mg	EUR 267.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5b rabbit pAb
266-A-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5a rabbit pAb
199-A-01mg	Virogen	0,1 mg	EUR 267.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

anti-HCV NS5a rabbit pAb
199-A-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

Rabbit anti-EBOV VP40 pAb
0301-010	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV NP pAb
0301-012	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV GP pAb
0301-015	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP35 pAb
0301-040	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb
0301-046	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb
0301-047	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP30 pAb
0301-048	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-SUDV VP40 pAb
0302-001	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-SUDV NP pAb
0302-012	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-SUDV GP pAb
0302-020	IBT Bioservices	500ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-SUDV sGP pAb
0302-030	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-MARV VP40 pAb
0303-001	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-MARV GP pAb
0303-007	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-MARV GP pAb
0303-007-bio	IBT Bioservices	100ug	EUR 608
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-MARV NP pAb
0303-012	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-BDBV GP pAb
0304-001	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-RESTV GP pAb
0305-001	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-CHIKV E2 pAb
0306-001	IBT Bioservices	100ug	EUR 506
Description: Related to: Alphaviruses Applications: ELISA, WB

Rabbit anti-LASV GP pAb
0307-001	IBT Bioservices	100ug	EUR 476
Description: Related to: Other Viruses Applications: ELISA, WB

Rabbit anti-LASV V pAb
0307-002	IBT Bioservices	100ug	EUR 476
Description: Related to: Other Viruses Applications: ELISA, WB

Rabbit anti-ZIKA GP pAb
0308-001	IBT Bioservices	100ug	EUR 481
Description: Related to: Other Viruses Applications: ELISA, WB

Rabbit anti-ZIKA NS1 pAb
0308-002	IBT Bioservices	100ug	EUR 481
Description: Related to: Other Viruses Applications: ELISA, WB

Rabbit anti-LukF-PV pAb
0312-002	IBT Bioservices	500ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-LukAB pAb (neutralizing)
0313-001	IBT Bioservices	500ug	EUR 405
Description: Related to: Staphylococcus Applications: Neutralization

Rabbit anti-Hlg B pAb
0314-001	IBT Bioservices	500ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-Hlg C pAb
0314-002	IBT Bioservices	500ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-EBOV VLP pAb
0315-001	IBT Bioservices	500ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-MARV VLP pAb
04-0005	IBT Bioservices	500ug	EUR 253
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-Chikungunya (CHIKV) pAb
04-0008	IBT Bioservices	500ug	EUR 293
Description: Related to: Alphaviruses Applications: ELISA, WB

Rabbit anti-LukS-PV pAb
04-0009	IBT Bioservices	500ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti DDDDK-Tag pAb
AE004	Abclonal	50 ul	EUR 195

Rabbit anti GST-Tag pAb
AE006	Abclonal	100 ul	EUR 195

Rabbit anti GFP-Tag pAb
AE011	Abclonal	50 ul	EUR 176

Rabbit anti V5-Tag pAb
AE022	Abclonal	50 ul	EUR 256

Rabbit anti HA-Tag pAb
AE036	Abclonal	100 ul	EUR 308

Rabbit anti His-Tag pAb
AE068	Abclonal	50 ul	EUR 195

pAb rabbit anti-human IL-4 receptor
CT248	U-CyTech	0.5 mg	EUR 184

Mouse Lymphocyte antigen 6E, Ly6e ELISA KIT
ELI-39137m	Lifescience Market	96 Tests	EUR 865

Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4719802	ABM	1.0 ug DNA	EUR 154

Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4719803	ABM	1.0 ug DNA	EUR 154

Ly6e sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4719804	ABM	1.0 ug DNA	EUR 154

LY6E Protein Vector (Mouse) (pPB-C-His)
PV198226	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)
PV198227	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)
PV198228	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)
PV198229	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)
PV198230	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)
PV198231	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)
PV198232	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)
PV198233	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)
PV198234	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)
PV198235	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)
PV198236	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)
PV198237	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)
PV198238	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)
PV198239	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)
PV198240	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)
PV198241	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)
PV198242	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)
PV198243	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)
PV198244	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)
PV198245	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-C-His)
PV198246	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPB-N-His)
PV198247	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-HA)
PV198248	ABM	500 ng	EUR 603

LY6E Protein Vector (Mouse) (pPM-C-His)
PV198249	ABM	500 ng	EUR 603

pAb rabbit anti-mouse TNF-α Biotin labeled
CT332	U-CyTech	0.5 mg	EUR 347

Anti-E.coli HCP
F117-PAB	Cygnus Technologies	1 ml	EUR 912
Product category: Antibodies
Description: Anti-E.coli HCP by Cygnus Technologies is available in Europe via Gentaur.

Anti-recombinant human MetAP-2 (full-length) Polyclonal Antibody
PAB-503208	Mediomics	1 viaL	EUR 352

Ly6e Polyclonal Antibody, Biotin Conjugated
A59691	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Ly6e Polyclonal Antibody, FITC Conjugated
A59692	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Ly6e Polyclonal Antibody, HRP Conjugated
A59693	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

LY6E Polyclonal Antibody, HRP Conjugated
A50918	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

LY6E Polyclonal Antibody, FITC Conjugated
A50919	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

LY6E Polyclonal Antibody, Biotin Conjugated
A50920	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Ly6e ORF Vector (Rat) (pORF)
ORF070119	ABM	1.0 ug DNA	EUR 506

Human Lymphocyte antigen 6E(LY6E) ELISA kit
CSB-EL013242HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 6E (LY6E) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lymphocyte antigen 6E(LY6E) ELISA kit
1-CSB-EL013242HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 6E(LY6E) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit anti-mouse, Human Ly6e pAb