Rabbit anti-Human MNDA, 0.1ml
Rabbit anti-Human MNDA, 0.1ml
MNDA Rabbit pAb |
A3963-50ul |
Abclonal |
50 ul |
Ask for price |
anti- MNDA antibody |
FNab05254 |
FN Test |
100µg |
EUR 585 |
- Immunogen: myeloid cell nuclear differentiation antigen
- Uniprot ID: P41218
- Gene ID: 4332
- Research Area: Metabolism
|
Description: Antibody raised against MNDA |
Anti-MNDA Antibody |
A06675 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human. |
Anti-MNDA antibody |
STJ94168 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MNDA. |
Anti-MNDA antibody |
STJ24595 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons. |
Anti-MNDA (1H2) |
YF-MA10575 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MNDA |
MNDA siRNA |
20-abx924348 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MNDA antibody |
70R-51593 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MNDA antibody |
MNDA antibody |
70R-34969 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal MNDA antibody |
MNDA antibody |
70R-8243 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MNDA antibody |
MNDA Antibody |
34813-100ul |
SAB |
100ul |
EUR 252 |
MNDA Antibody |
34813-50ul |
SAB |
50ul |
EUR 187 |
MNDA antibody |
70R-18556 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MNDA antibody |
MNDA Antibody |
DF4191 |
Affbiotech |
200ul |
EUR 304 |
Description: MNDA Antibody detects endogenous levels of total MNDA. |
MNDA Antibody |
1-CSB-PA010214 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
MNDA Antibody |
CSB-PA192245- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
MNDA Antibody |
CSB-PA192245-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
MNDA Antibody |
1-CSB-PA014688GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MNDA Antibody |
1-CSB-PA014688LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
Human MNDA shRNA Plasmid |
20-abx952943 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MNDA Recombinant Protein (Human) |
RP019663 |
ABM |
100 ug |
Ask for price |
MNDA Conjugated Antibody |
C34813 |
SAB |
100ul |
EUR 397 |
MNDA cloning plasmid |
CSB-CL014688HU-10ug |
Cusabio |
10ug |
EUR 453 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1224
- Sequence: atggtgaatgaatacaagaaaattcttttgctgaaaggatttgagctcatggatgattatcattttacatcaattaagtccttactggcctatgatttaggactaactacaaaaatgcaagaggaatacaacagaattaagattacagatttgatggaaaaaaagttccaaggcg
- Show more
|
Description: A cloning plasmid for the MNDA gene. |
MNDA Polyclonal Antibody |
ES6265-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MNDA from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MNDA Polyclonal Antibody |
ES6265-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MNDA from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MNDA Polyclonal Antibody |
ABP55266-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430
- Applications tips:
|
Description: A polyclonal antibody for detection of MNDA from Human. This MNDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430 |
MNDA Polyclonal Antibody |
ABP55266-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430
- Applications tips:
|
Description: A polyclonal antibody for detection of MNDA from Human. This MNDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430 |
MNDA Polyclonal Antibody |
ABP55266-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430
- Applications tips:
|
Description: A polyclonal antibody for detection of MNDA from Human. This MNDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430 |
MNDA Blocking Peptide |
20-abx062168 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MNDA Blocking Peptide |
33R-4268 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MNDA antibody, catalog no. 70R-8243 |
MNDA Polyclonal Antibody |
41159-100ul |
SAB |
100ul |
EUR 252 |
MNDA Polyclonal Antibody |
41159-50ul |
SAB |
50ul |
EUR 187 |
MNDA Blocking Peptide |
DF4191-BP |
Affbiotech |
1mg |
EUR 195 |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
MNDA ORF Vector (Human) (pORF) |
ORF006555 |
ABM |
1.0 ug DNA |
EUR 95 |
MNDA ELISA Kit (Human) (OKEH04704) |
OKEH04704 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL |
MNDA protein (His tag) |
80R-1237 |
Fitzgerald |
100 ug |
EUR 586 |
Description: Purified recombinant Human MNDA protein |
MNDA Antibody, HRP conjugated |
1-CSB-PA014688LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MNDA Antibody, FITC conjugated |
1-CSB-PA014688LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MNDA Antibody, Biotin conjugated |
1-CSB-PA014688LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MNDA Recombinant Protein (Mouse) |
RP151025 |
ABM |
100 ug |
Ask for price |
MNDA sgRNA CRISPR Lentivector set (Human) |
K1314001 |
ABM |
3 x 1.0 ug |
EUR 339 |
NATtrol Strep A Verification Panel (24 x 0.1mL) |
NATSAVP1-C |
Zeptometrix |
24 x 0.1mL |
EUR 632.4 |
- What is the product classification?
- NATtrol Strep A Verification Panel is marked as RUO.
|
Description: Please contact Gentaur in order to receive the datasheet of the product. |
Polyclonal MNDA Antibody (N-term) |
APR17401G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MNDA (N-term). This antibody is tested and proven to work in the following applications: |
Mnda ORF Vector (Mouse) (pORF) |
ORF050343 |
ABM |
1.0 ug DNA |
EUR 506 |
MNDA sgRNA CRISPR Lentivector (Human) (Target 1) |
K1314002 |
ABM |
1.0 ug DNA |
EUR 154 |
MNDA sgRNA CRISPR Lentivector (Human) (Target 2) |
K1314003 |
ABM |
1.0 ug DNA |
EUR 154 |
MNDA sgRNA CRISPR Lentivector (Human) (Target 3) |
K1314004 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human MNDA Protein, His, E.coli-10ug |
QP12711-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human MNDA Protein, His, E.coli-1mg |
QP12711-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human MNDA Protein, His, E.coli-2ug |
QP12711-2ug |
EnQuireBio |
2ug |
EUR 155 |
MNDA Protein Vector (Human) (pPB-C-His) |
PV026217 |
ABM |
500 ng |
EUR 329 |
MNDA Protein Vector (Human) (pPB-N-His) |
PV026218 |
ABM |
500 ng |
EUR 329 |
MNDA Protein Vector (Human) (pPM-C-HA) |
PV026219 |
ABM |
500 ng |
EUR 329 |
MNDA Protein Vector (Human) (pPM-C-His) |
PV026220 |
ABM |
500 ng |
EUR 329 |
Human Myeloid Cell Nuclear Differentiation Antigen (MNDA) Protein |
20-abx166669 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mnda sgRNA CRISPR Lentivector set (Mouse) |
K3573501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human MNDA/ Myeloid cell nuclear differentiation antigen ELISA Kit |
E1624Hu |
Sunlong |
1 Kit |
EUR 571 |
Human MNDA(Myeloid cell nuclear differentiation antigen) ELISA Kit |
EH1924 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P41218
- Alias: MNDA/Myeloid cell nuclear differentiation antigen
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human myeloid cell nuclear differentiation antigen(MNDA)ELISA Kit |
GA-E0245HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human myeloid cell nuclear differentiation antigen(MNDA)ELISA Kit |
GA-E0245HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Myeloid cell nuclear differentiation antigen (MNDA) ELISA Kit |
abx251243-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
human myeloid cell nuclear differentiation antigen,MNDA ELISA Kit |
201-12-0229 |
SunredBio |
96 tests |
EUR 440 |
- This myeloid cell nuclear differentiation antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human) |
4-PAB775Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA) |
Human myeloid cell nuclear differentiation antigen(MNDA)ELISA Kit |
QY-E01355 |
Qayee Biotechnology |
96T |
EUR 361 |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx113913 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx128809 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx002901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx007480 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
abx026169-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
abx026169-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx014609 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx324606 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
abx330744-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
20-abx318271 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody |
abx235254-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Protein |
20-abx262871 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Mnda sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3573502 |
ABM |
1.0 ug DNA |
EUR 154 |
Mnda sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3573503 |
ABM |
1.0 ug DNA |
EUR 154 |
Mnda sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3573504 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Myeloid Cell Nuclear Differentiation Antigen (MNDA) |
4-RPB775Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P41218
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.5kDa
- Isoelectric Point: 9.8
|
Description: Recombinant Human Myeloid Cell Nuclear Differentiation Antigen expressed in: E.coli |
MNDA Protein Vector (Mouse) (pPB-C-His) |
PV201370 |
ABM |
500 ng |
EUR 603 |
MNDA Protein Vector (Mouse) (pPB-N-His) |
PV201371 |
ABM |
500 ng |
EUR 603 |
MNDA Protein Vector (Mouse) (pPM-C-HA) |
PV201372 |
ABM |
500 ng |
EUR 603 |
MNDA Protein Vector (Mouse) (pPM-C-His) |
PV201373 |
ABM |
500 ng |
EUR 603 |
Mnda 3'UTR GFP Stable Cell Line |
TU163299 |
ABM |
1.0 ml |
Ask for price |
MNDA 3'UTR Luciferase Stable Cell Line |
TU014412 |
ABM |
1.0 ml |
EUR 1394 |
Mnda 3'UTR Luciferase Stable Cell Line |
TU113299 |
ABM |
1.0 ml |
Ask for price |
MNDA 3'UTR GFP Stable Cell Line |
TU064412 |
ABM |
1.0 ml |
EUR 1394 |
MNDA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K1314005 |
ABM |
3 x 1.0 ug |
EUR 376 |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), APC |
4-PAB775Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with APC. |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), Biotinylated |
4-PAB775Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with Biotin. |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), Cy3 |
4-PAB775Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with Cy3. |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), FITC |
4-PAB775Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with FITC. |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), HRP |
4-PAB775Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with HRP. |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), PE |
4-PAB775Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with PE. |
ELISA kit for Human Myeloid cell nuclear differentiation antigen,MNDA |
KTE61578-48T |
Abbkine |
48T |
EUR 332 |
- The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Myeloid cell nuclear differentiation antigen,MNDA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Myeloid cell nuclear differentiation antigen,MNDA |
KTE61578-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Myeloid cell nuclear differentiation antigen,MNDA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Myeloid cell nuclear differentiation antigen,MNDA |
KTE61578-96T |
Abbkine |
96T |
EUR 539 |
- The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Myeloid cell nuclear differentiation antigen,MNDA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
0.1ml 8-tube PCR strip, flat cap, clear, sterile, 125 pcs/pk |
210108-13pk |
ACTGene |
|
EUR 151 |
0.1ml 12-tube PCR strip, flat cap, clear, sterile, 80 pcs/pk |
210112-13pk |
ACTGene |
|
EUR 165 |
0.1ml 8-tube PCR strip, dome cap, clear, sterile, 125 pcs/pk |
220108-13pk |
ACTGene |
|
EUR 151 |
0.1ml 12-tube PCR strip, dome cap, clear, sterile, 80 pcs/pk |
220112-13pk |
ACTGene |
|
EUR 165 |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody (HRP) |
20-abx317024 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody (FITC) |
20-abx317025 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody (Biotin) |
20-abx317026 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody (FITC) |
abx200552-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 3-5 working days.
|
Rabbit Anti Human IgG |
E61I00101 |
EnoGene |
100ug |
EUR 343 |
Rabbit anti Human IgG |
40C-CB0943 |
Fitzgerald |
1 mg |
EUR 249 |
Description: Rabbit anti Human IgG secondary antibody |
Rabbit anti Human IgG |
40C-CB0950 |
Fitzgerald |
5 mg |
EUR 381 |
Description: Rabbit anti Human IgG secondary antibody |
Rabbit anti Human IgG |
40C-CB0971 |
Fitzgerald |
2 mg |
EUR 322 |
Description: Rabbit anti Human IgG secondary antibody |
Rabbit anti Human IgM |
40C-CB9100 |
Fitzgerald |
2 mg |
EUR 283 |
Description: Rabbit anti Human IgM secondary antibody |
Rabbit anti Human IgA |
40C-CB9114 |
Fitzgerald |
2 mg |
EUR 259 |
Description: Rabbit anti Human IgA secondary antibody |
Rabbit anti Human IgE |
20-IR77 |
Fitzgerald |
1 ml |
EUR 192 |
Description: Rabbit anti Human IgE antibody |
MNDA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1314006 |
ABM |
1.0 ug DNA |
EUR 167 |
MNDA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K1314007 |
ABM |
1.0 ug DNA |
EUR 167 |
MNDA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1314008 |
ABM |
1.0 ug DNA |
EUR 167 |
Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB775Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MNDA (Thr189~Asn405)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA). This antibody is labeled with APC-Cy7. |
Rabbit Anti-Human IgG FC |
C020221-1mg |
Unibiotest |
1mg |
EUR 269 |
Rabbit Anti-Human IgG FC |
C020221-50mg |
Unibiotest |
50mg |
EUR 6015 |
Rabbit Anti Human IgG-Biotin |
E61I00102 |
EnoGene |
1mg |
EUR 499 |
Rabbit Anti Human IgG-HRP |
E61I00103 |
EnoGene |
1mg |
EUR 499 |
Rabbit Anti Human IgG-FITC |
E61I00104 |
EnoGene |
1mg |
EUR 611 |
Rabbit Anti-Human IgM Antibody |
20-abx134798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Anti-Human IgA Antibody |
abx019263-01ml |
Abbexa |
0.1 ml |
EUR 328 |
- Shipped within 5-10 working days.
|
Rabbit anti Human IgG (FITC) |
43C-CB0944 |
Fitzgerald |
1 mg |
EUR 311 |
Description: Rabbit anti Human IgG secondary antibody (FITC) |
Rabbit anti Human IgG (rhodamine) |
43C-CB0945 |
Fitzgerald |
1 mg |
EUR 348 |
Description: Rabbit anti Human IgG secondary antibody (Rhodamine) |
Rabbit anti Human IgG (biotin) |
43C-CB0947 |
Fitzgerald |
1 mg |
EUR 340 |
Description: Rabbit anti Human IgG secondary antibody (biotin) |
Rabbit anti Human IgG (HRP) |
43C-CB0948 |
Fitzgerald |
1 mg |
EUR 417 |
Description: Rabbit anti Human IgG secondary antibody (HRP) |
Rabbit anti Human IgG (FITC) |
43C-CB0951 |
Fitzgerald |
2 mg |
EUR 273 |
Description: Rabbit anti Human IgG secondary antibody (FITC) |
Rabbit anti Human IgG (rhodamine) |
43C-CB0952 |
Fitzgerald |
2 mg |
EUR 278 |
Description: Rabbit anti Human IgG secondary antibody (Rhodamine) |
Rabbit anti Human IgG (biotin) |
43C-CB0954 |
Fitzgerald |
2 mg |
EUR 340 |
Description: Rabbit anti Human IgG secondary antibody (biotin) |
Rabbit anti Human IgG (HRP) |
43C-CB0955 |
Fitzgerald |
2 mg |
EUR 361 |
Description: Rabbit anti Human IgG secondary antibody (HRP) |
Rabbit anti Human IgG (FITC) |
43C-CB0965 |
Fitzgerald |
2 mg |
EUR 291 |
Description: Rabbit anti Human IgG secondary antibody (FITC) |
Rabbit anti Human IgG (rhodamine) |
43C-CB0966 |
Fitzgerald |
2 mg |
EUR 291 |
Description: Rabbit anti Human IgG secondary antibody (Rhodamine) |
Rabbit anti Human IgG (biotin) |
43C-CB0968 |
Fitzgerald |
2 mg |
EUR 359 |
Description: Rabbit anti Human IgG secondary antibody (biotin) |
Rabbit anti Human IgG (HRP) |
43C-CB0969 |
Fitzgerald |
2 mg |
EUR 369 |
Description: Rabbit anti Human IgG secondary antibody (HRP) |
Rabbit anti Human IgM (FITC) |
43C-CB9101 |
Fitzgerald |
1.5 mg |
EUR 315 |
Description: Rabbit anti Human IgM secondary antibody (FITC) |
Rabbit anti Human IgM (rhodamine) |
43C-CB9102 |
Fitzgerald |
1.5 mg |
EUR 302 |
Description: Rabbit anti Human IgM secondary antibody (Rhodamine) |
Rabbit anti Human IgM (biotin) |
43C-CB9104 |
Fitzgerald |
1.5 mg |
EUR 357 |
Description: Rabbit anti Human IgM secondary antibody (biotin) |
Rabbit anti Human IgM (HRP) |
43C-CB9105 |
Fitzgerald |
1.5 mg |
EUR 392 |
Description: Rabbit anti Human IgM secondary antibody (HRP) |
Rabbit anti Human IgA (FITC) |
43C-CB9115 |
Fitzgerald |
1 mg |
EUR 294 |
Description: Rabbit anti Human IgA secondary antibody (FITC) |
Rabbit anti Human IgA (rhodamine) |
43C-CB9116 |
Fitzgerald |
1 mg |
EUR 301 |
Description: Rabbit anti Human IgA secondary antibody (Rhodamine) |
Rabbit anti Human IgA (biotin) |
43C-CB9118 |
Fitzgerald |
1 mg |
EUR 361 |
Description: Rabbit anti Human IgA secondary antibody (biotin) |
Rabbit anti Human IgA (HRP) |
43C-CB9119 |
Fitzgerald |
1 mg |
EUR 368 |
Description: Rabbit anti Human IgA secondary antibody (HRP) |
pAb rabbit anti-human EPO |
CT282 |
U-CyTech |
0.5 mg |
EUR 184 |
Anti-CD63 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-CD63A-1 |
SBI |
25 ul |
EUR 219 |
|
Anti-CD81 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-CD81A-1 |
SBI |
25 ul |
EUR 219 |
|
Anti-CD9 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-CD9A-1 |
SBI |
25 ul |
EUR 219 |
|
Anti-Hsp70 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-Hsp70A-1 |
SBI |
25 ul |
EUR 219 |
|
0.1ml 8-tube Real-Time PCR strip, flat cap, white, sterile, 125 pcs/pk |
210108R-13pk |
ACTGene |
|
EUR 168 |
0.1ml 12-tube Real-Time PCR strip, flat cap, white, sterile, 80 pcs/pk |
210112R-13pk |
ACTGene |
|
EUR 170 |
Mnda sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3573505 |
ABM |
3 x 1.0 ug |
EUR 376 |
Rabbit anti Bovine |
E61I02501 |
EnoGene |
0.1mg |
EUR 343 |
Rabbit anti-Human MNDA, 0.1ml