Rabbit anti-Human MNDA, 0.1ml

Rabbit anti-Human MNDA, 0.1ml 

To Order Contact us: caitlyn@ucb-bioproducts.com

MNDA Rabbit pAb

A3963-50ul 50 ul Ask for price

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

anti- MNDA antibody

FNab05254 100µg
EUR 585
  • Immunogen: myeloid cell nuclear differentiation antigen
  • Uniprot ID: P41218
  • Gene ID: 4332
  • Research Area: Metabolism
Description: Antibody raised against MNDA

Anti-MNDA antibody

PAab05254 100 ug
EUR 412

Anti-MNDA antibody

STJ24595 100 µl
EUR 277
Description: The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons.

Anti-MNDA antibody

STJ94168 200 µl
EUR 197
Description: Rabbit polyclonal to MNDA.

Anti-MNDA (1H2)

YF-MA10575 100 ug
EUR 363
Description: Mouse monoclonal to MNDA

MNDA

MNDAF-100T 100 test
EUR 388

MNDA antibody

70R-18556 50 ul
EUR 435
Description: Rabbit polyclonal MNDA antibody

MNDA Antibody

34813-100ul 100ul
EUR 252

MNDA Antibody

34813-50ul 50ul
EUR 187

MNDA Antibody

DF4191 200ul
EUR 304
Description: MNDA Antibody detects endogenous levels of total MNDA.

MNDA Antibody

CSB-PA192245-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MNDA Antibody

CSB-PA192245-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MNDA Antibody

1-CSB-PA014688GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MNDA Antibody

1-CSB-PA014688LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

MNDA antibody

70R-34969 100 ug
EUR 327
Description: Purified Rabbit polyclonal MNDA antibody

MNDA antibody

70R-8243 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MNDA antibody

MNDA antibody

70R-51593 100 ul
EUR 244
Description: Purified Polyclonal MNDA antibody

MNDA Antibody

1-CSB-PA010214
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

MNDA siRNA

20-abx924348
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MNDA Antibody

ABD4191 100 ug
EUR 438

Human MNDA ELISA Kit

ELA-E1775h 96 Tests
EUR 824

Human MNDA ELISA KIT

ELI-05756h 96 Tests
EUR 824

MNDA ELISA KIT|Human

EF006035 96 Tests
EUR 689

Human MNDA shRNA Plasmid

20-abx952943
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MNDA Recombinant Protein (Human)

RP019663 100 ug Ask for price

MNDA Blocking Peptide

33R-4268 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MNDA antibody, catalog no. 70R-8243

MNDA Polyclonal Antibody

41159-100ul 100ul
EUR 252

MNDA Polyclonal Antibody

41159-50ul 50ul
EUR 187

MNDA Blocking Peptide

DF4191-BP 1mg
EUR 195

MNDA Polyclonal Antibody

ABP55266-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of MNDA from Human. This MNDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430

MNDA Polyclonal Antibody

ABP55266-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of MNDA from Human. This MNDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430

MNDA Polyclonal Antibody

ABP55266-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of MNDA from Human. This MNDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MNDA at AA rangle: 350-430

MNDA Blocking Peptide

20-abx062168
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MNDA Conjugated Antibody

C34813 100ul
EUR 397

MNDA cloning plasmid

CSB-CL014688HU-10ug 10ug
EUR 453
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1224
  • Sequence: atggtgaatgaatacaagaaaattcttttgctgaaaggatttgagctcatggatgattatcattttacatcaattaagtccttactggcctatgatttaggactaactacaaaaatgcaagaggaatacaacagaattaagattacagatttgatggaaaaaaagttccaaggcg
  • Show more
Description: A cloning plasmid for the MNDA gene.

MNDA Polyclonal Antibody

ES6265-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MNDA from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MNDA Polyclonal Antibody

ES6265-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MNDA from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

MNDA ORF Vector (Human) (pORF)

ORF006555 1.0 ug DNA
EUR 95

MNDA ELISA Kit (Human) (OKEH04704)

OKEH04704 96 Wells
EUR 662
Description: Description of target: The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

MNDA Antibody, HRP conjugated

1-CSB-PA014688LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MNDA Antibody, FITC conjugated

1-CSB-PA014688LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MNDA Antibody, Biotin conjugated

1-CSB-PA014688LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MNDA. Recognizes MNDA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MNDA protein (His tag)

80R-1237 100 ug
EUR 586
Description: Purified recombinant Human MNDA protein

pCMV-SPORT6-MNDA Plasmid

PVT16667 2 ug
EUR 325

MNDA Recombinant Protein (Mouse)

RP151025 100 ug Ask for price

MNDA sgRNA CRISPR Lentivector set (Human)

K1314001 3 x 1.0 ug
EUR 339

Polyclonal MNDA Antibody (N-term)

APR17401G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MNDA (N-term). This antibody is tested and proven to work in the following applications:

Mnda ORF Vector (Mouse) (pORF)

ORF050343 1.0 ug DNA
EUR 506

MNDA sgRNA CRISPR Lentivector (Human) (Target 1)

K1314002 1.0 ug DNA
EUR 154

MNDA sgRNA CRISPR Lentivector (Human) (Target 2)

K1314003 1.0 ug DNA
EUR 154

MNDA sgRNA CRISPR Lentivector (Human) (Target 3)

K1314004 1.0 ug DNA
EUR 154

MNDA Protein Vector (Human) (pPB-C-His)

PV026217 500 ng
EUR 329

MNDA Protein Vector (Human) (pPB-N-His)

PV026218 500 ng
EUR 329

MNDA Protein Vector (Human) (pPM-C-HA)

PV026219 500 ng
EUR 329

MNDA Protein Vector (Human) (pPM-C-His)

PV026220 500 ng
EUR 329

Recombinant Human MNDA Protein, His, E.coli-10ug

QP12711-10ug 10ug
EUR 201

Recombinant Human MNDA Protein, His, E.coli-1mg

QP12711-1mg 1mg
EUR 5251

Recombinant Human MNDA Protein, His, E.coli-2ug

QP12711-2ug 2ug
EUR 155

NATtrol Strep A Verification Panel (24 x 0.1mL)

NATSAVP1-C 24 x 0.1mL
EUR 632.4
  • What is the product classification?
  • NATtrol Strep A Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Human Myeloid Cell Nuclear Differentiation Antigen (MNDA) Protein

20-abx166669
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mnda sgRNA CRISPR Lentivector set (Mouse)

K3573501 3 x 1.0 ug
EUR 339

human myeloid cell nuclear differentiation antigen,MNDA ELISA Kit

201-12-0229 96 tests
EUR 440
  • This myeloid cell nuclear differentiation antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Myeloid cell nuclear differentiation antigen (MNDA) ELISA Kit

abx251243-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MNDA/ Myeloid cell nuclear differentiation antigen ELISA Kit

E1624Hu 1 Kit
EUR 571

Human MNDA(Myeloid cell nuclear differentiation antigen) ELISA Kit

EH1924 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P41218
  • Alias: MNDA/Myeloid cell nuclear differentiation antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human myeloid cell nuclear differentiation antigen(MNDA)ELISA Kit

GA-E0245HM-48T 48T
EUR 289

Human myeloid cell nuclear differentiation antigen(MNDA)ELISA Kit

GA-E0245HM-96T 96T
EUR 466

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Polyclonal Antibody (Human)

4-PAB775Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MNDA (Thr189~Asn405)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myeloid Cell Nuclear Differentiation Antigen (MNDA)

Human myeloid cell nuclear differentiation antigen(MNDA)ELISA Kit

QY-E01355 96T
EUR 361

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx007480
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

abx026169-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

abx026169-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx002901
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx113913
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx128809
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx014609
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

abx235254-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

abx330744-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx324606
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Antibody

20-abx318271
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myeloid Cell Nuclear Differentiation Antigen (MNDA) Protein

20-abx262871
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Mnda sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3573502 1.0 ug DNA
EUR 154

Mnda sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3573503 1.0 ug DNA
EUR 154

Mnda sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3573504 1.0 ug DNA
EUR 154

MNDA Protein Vector (Mouse) (pPB-C-His)

PV201370 500 ng
EUR 603

MNDA Protein Vector (Mouse) (pPB-N-His)

PV201371 500 ng
EUR 603

MNDA Protein Vector (Mouse) (pPM-C-HA)

PV201372 500 ng
EUR 603

MNDA Protein Vector (Mouse) (pPM-C-His)

PV201373 500 ng
EUR 603

Recombinant Myeloid Cell Nuclear Differentiation Antigen (MNDA)

4-RPB775Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P41218
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.5kDa
  • Isoelectric Point: 9.8
Description: Recombinant Human Myeloid Cell Nuclear Differentiation Antigen expressed in: E.coli

Mnda 3'UTR Luciferase Stable Cell Line

TU113299 1.0 ml Ask for price

Rabbit anti-Human MNDA, 0.1ml