Rabbit anti-Human GP1BA, 0.4ml

Rabbit anti-Human GP1BA, 0.4ml 

To Order Contact us: caitlyn@ucb-bioproducts.com

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

RDR-GP1Ba-Hu-96Tests 96 Tests
EUR 724

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

RD-GP1Ba-Hu-48Tests 48 Tests
EUR 500

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

RD-GP1Ba-Hu-96Tests 96 Tests
EUR 692

GP1BA Rabbit pAb

A16048-100ul 100 ul
EUR 308

GP1BA Rabbit pAb

A16048-200ul 200 ul
EUR 459

GP1BA Rabbit pAb

A16048-20ul 20 ul
EUR 183

GP1BA Rabbit pAb

A16048-50ul 50 ul
EUR 223

Anti-GP1BA antibody

STJ118501 100 µl
EUR 277

Rabbit Glycocalicin (GP1BA) ELISA Kit

abx355223-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

GP1BA antibody

70R-17553 50 ul
EUR 435
Description: Rabbit polyclonal GP1BA antibody

GP1BA Antibody

36512-100ul 100ul
EUR 252

GP1BA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

GP1BA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GP1BA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:100-1:300

GP1BA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


ELA-E1710h 96 Tests
EUR 824


EF002776 96 Tests
EUR 689

Human GP1BA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GP1BA Recombinant Protein (Human)

RP013678 100 ug Ask for price

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GP1BA Conjugated Antibody

C36512 100ul
EUR 397

GP1BA cloning plasmid

CSB-CL009685HU-10ug 10ug
EUR 636
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1881
  • Sequence: atgcctctcctcctcttgctgctcctgctgccaagccccttacacccccaccccatctgtgaggtctccaaagtggccagccacctagaagtgaactgtgacaagaggaatctgacagcgctgcctccagacctgccgaaagacacaaccatcctccacctgagtgagaacctcc
  • Show more
Description: A cloning plasmid for the GP1BA gene.

Human Glycocalicin (GP1BA) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycocalicin (GP1BA) ELISA Kit

abx570254-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

GP1BA ORF Vector (Human) (pORF)

ORF004560 1.0 ug DNA
EUR 95

GP1BA ELISA Kit (Human) (OKAN05260)

OKAN05260 96 Wells
EUR 792
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.3 pg/mL

GP1BA ELISA Kit (Human) (OKAN05261)

OKAN05261 96 Wells
EUR 792
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.35 ng/mL

GP1BA ELISA Kit (Human) (OKCD07149)

OKCD07149 96 Wells
EUR 936
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. GP1BA is the alpha subunit.Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.35ng/mL

GP1BA ELISA Kit (Human) (OKCD07618)

OKCD07618 96 Wells
EUR 936
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. GP1BA is the alpha subunit.Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 7.5pg/mL

GP1BA ELISA Kit (Human) (OKEH01226)

OKEH01226 96 Wells
EUR 662
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.6 pg/mL


ELI-05548d 96 Tests
EUR 928

Mouse GP1BA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16547 2 ug
EUR 325

GP1BA Recombinant Protein (Rat)

RP203150 100 ug Ask for price

GP1BA Recombinant Protein (Mouse)

RP139199 100 ug Ask for price

GP1BA sgRNA CRISPR Lentivector set (Human)

K0884601 3 x 1.0 ug
EUR 339

Rabbit Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx362229-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Polyclonal GP1BA(Glycocalicin) Antibody (Center)

APR04673G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GP1BA(Glycocalicin) (Center). This antibody is tested and proven to work in the following applications:

Chicken Glycocalicin (GP1BA) ELISA Kit

abx354765-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Glycocalicin (GP1BA) ELISA Kit

abx354952-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Glycocalicin (GP1BA) ELISA Kit

abx355111-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Glycocalicin (GP1BA) ELISA Kit

abx355358-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Gp1ba ORF Vector (Rat) (pORF)

ORF067718 1.0 ug DNA
EUR 506

Gp1ba ORF Vector (Mouse) (pORF)

ORF046401 1.0 ug DNA
EUR 506

GP1BA ELISA Kit (Mouse) (OKCA02430)

OKCA02430 96 Wells
EUR 846
Description: Description of target: GP-Ib, a surface membrane protein of platelets, participates in the formation of platelet plugs by binding to the A1 domain of vWF, which is already bound to the subendothelium.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 11.72 pg/mL

GP1BA ELISA Kit (Mouse) (OKEH05365)

OKEH05365 96 Wells
EUR 662
Description: Description of target: GP-Ib, a surface membrane protein of platelets, participates in the formation of platelet plugs by binding to the A1 domain of vWF, which is already bound to the subendothelium.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.82 pg/mL

Human Platelet glycoprotein Ib alpha chain (GP1BA)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 83.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in E.coli

Human Platelet glycoprotein Ib alpha chain (GP1BA)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 57.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in E.coli

Human Platelet glycoprotein Ib alpha chain (GP1BA)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in E.coli

Human Platelet glycoprotein Ib alpha chain (GP1BA)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 58.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in Yeast

GP1BA sgRNA CRISPR Lentivector (Human) (Target 1)

K0884602 1.0 ug DNA
EUR 154

GP1BA sgRNA CRISPR Lentivector (Human) (Target 2)

K0884603 1.0 ug DNA
EUR 154

GP1BA sgRNA CRISPR Lentivector (Human) (Target 3)

K0884604 1.0 ug DNA
EUR 154

GP1BA Protein Vector (Human) (pPB-C-His)

PV018237 500 ng
EUR 329

GP1BA Protein Vector (Human) (pPB-N-His)

PV018238 500 ng
EUR 329

GP1BA Protein Vector (Human) (pPM-C-HA)

PV018239 500 ng
EUR 329

GP1BA Protein Vector (Human) (pPM-C-His)

PV018240 500 ng
EUR 329

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Peptide

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Glycocalicin (GP1BA) ELISA Kit

abx354841-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Gp1ba sgRNA CRISPR Lentivector set (Rat)

K6723301 3 x 1.0 ug
EUR 339

Gp1ba sgRNA CRISPR Lentivector set (Mouse)

K3344601 3 x 1.0 ug
EUR 339

Human Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx250700-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx251209-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human GP1BA/ Platelet glycoprotein Ib alpha chain ELISA Kit

E1037Hu 1 Kit
EUR 571

Human Platelet glycoprotein Ib alpha chain, GP1BA ELISA KIT

ELI-05547h 96 Tests
EUR 824

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba)

Human Glycoprotein Ib Alpha Polypeptide, Platelet ELISA Kit (GP1Ba)

RK01486 96 Tests
EUR 521

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

SEB108Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma.

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

SEB108Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma.

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

SEB108Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma.

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

SEB108Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma.

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glycoprotein Ib Alpha Polypeptide, Platelet elisa. Alternative names of the recognized antigen: CD42b
  • CD42-B
  • CD42b-Alpha
  • GP1-BA
  • BSS
  • GP1B
  • Glycocalicin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in samples from Plasma with no significant corss-reactivity with analogues from other species.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody

  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

Platelet Glycoprotein Ib Alpha Chain (GP1BA) Antibody

abx340135-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal GP1BA Antibody (monoclonal) (M02), Clone: 1C6

AMM03588G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GP1BA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1C6. This antibody is applicable in WB, IP, E

Gp1ba sgRNA CRISPR Lentivector (Rat) (Target 1)

K6723302 1.0 ug DNA
EUR 154

Gp1ba sgRNA CRISPR Lentivector (Rat) (Target 2)

K6723303 1.0 ug DNA
EUR 154

Gp1ba sgRNA CRISPR Lentivector (Rat) (Target 3)

K6723304 1.0 ug DNA
EUR 154

Gp1ba sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3344602 1.0 ug DNA
EUR 154

Gp1ba sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3344603 1.0 ug DNA
EUR 154

Gp1ba sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3344604 1.0 ug DNA
EUR 154

GP1BA Protein Vector (Rat) (pPB-C-His)

PV270870 500 ng
EUR 1166

GP1BA Protein Vector (Rat) (pPB-N-His)

PV270871 500 ng
EUR 1166

GP1BA Protein Vector (Rat) (pPM-C-HA)

PV270872 500 ng
EUR 1166

GP1BA Protein Vector (Rat) (pPM-C-His)

PV270873 500 ng
EUR 1166

GP1BA Protein Vector (Mouse) (pPB-C-His)

PV185602 500 ng
EUR 1065

GP1BA Protein Vector (Mouse) (pPB-N-His)

PV185603 500 ng
EUR 1065

GP1BA Protein Vector (Mouse) (pPM-C-HA)

PV185604 500 ng
EUR 1065

GP1BA Protein Vector (Mouse) (pPM-C-His)

PV185605 500 ng
EUR 1065

Recombinant Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07359
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.0kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Glycoprotein Ib Alpha Polypeptide, Platelet expressed in: E.coli

Recombinant Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba)

  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35930
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Glycoprotein Ib Alpha Polypeptide, Platelet expressed in: E.coli

Gp1ba 3'UTR Luciferase Stable Cell Line

TU108915 1.0 ml Ask for price

Gp1ba 3'UTR Luciferase Stable Cell Line

TU205275 1.0 ml Ask for price

Gp1ba 3'UTR GFP Stable Cell Line

TU158915 1.0 ml Ask for price

Gp1ba 3'UTR GFP Stable Cell Line

TU255275 1.0 ml Ask for price

GP1BA 3'UTR GFP Stable Cell Line

TU059093 1.0 ml
EUR 1394

GP1BA 3'UTR Luciferase Stable Cell Line

TU009093 1.0 ml
EUR 1394

Rabbit anti Human IgE

20-IR77 1 ml
EUR 192
Description: Rabbit anti Human IgE antibody

Rabbit anti Human IgG

40C-CB0943 1 mg
EUR 249
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0950 5 mg
EUR 381
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0971 2 mg
EUR 322
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgM

40C-CB9100 2 mg
EUR 283
Description: Rabbit anti Human IgM secondary antibody

Rabbit anti Human IgA

40C-CB9114 2 mg
EUR 259
Description: Rabbit anti Human IgA secondary antibody

Rabbit Anti Human IgG

E61I00101 100ug
EUR 343

ELISA kit for Human GP1Ba (Glycoprotein Ib Alpha Polypeptide, Platelet)

ELK4501 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycoprotein Ib Alpha Polypeptide, Platelet (GP1B?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant
  • Show more
Description: A sandwich ELISA kit for detection of Glycoprotein Ib Alpha Polypeptide, Platelet from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0884605 3 x 1.0 ug
EUR 376

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with APC.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with Biotin.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with Cy3.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with FITC.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with HRP.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with PE.

Mouse Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Peptide

  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody (FITC)

  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody (APC)

  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody (PE)

  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

GP1BA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV647485 1.0 ug DNA
EUR 1355

GP1BA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV647489 1.0 ug DNA
EUR 1355

GP1BA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV647490 1.0 ug DNA
EUR 1355

GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0884606 1.0 ug DNA
EUR 167

GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0884607 1.0 ug DNA
EUR 167

GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0884608 1.0 ug DNA
EUR 167

Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GP1Ba (Ile19~Leu291)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with APC-Cy7.

Rabbit anti Human IgG (FITC)

43C-CB0944 1 mg
EUR 311
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0945 1 mg
EUR 348
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0947 1 mg
EUR 340
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0948 1 mg
EUR 417
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgG (FITC)

43C-CB0951 2 mg
EUR 273
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0952 2 mg
EUR 278
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0954 2 mg
EUR 340
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0955 2 mg
EUR 361
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgG (FITC)

43C-CB0965 2 mg
EUR 291
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0966 2 mg
EUR 291
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0968 2 mg
EUR 359
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0969 2 mg
EUR 369
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgM (FITC)

43C-CB9101 1.5 mg
EUR 315
Description: Rabbit anti Human IgM secondary antibody (FITC)

Rabbit anti Human IgM (rhodamine)

43C-CB9102 1.5 mg
EUR 302
Description: Rabbit anti Human IgM secondary antibody (Rhodamine)

Rabbit anti Human IgM (biotin)

43C-CB9104 1.5 mg
EUR 357
Description: Rabbit anti Human IgM secondary antibody (biotin)

Rabbit anti Human IgM (HRP)

43C-CB9105 1.5 mg
EUR 392
Description: Rabbit anti Human IgM secondary antibody (HRP)

Rabbit anti Human IgA (FITC)

43C-CB9115 1 mg
EUR 294
Description: Rabbit anti Human IgA secondary antibody (FITC)

Rabbit anti Human IgA (rhodamine)

43C-CB9116 1 mg
EUR 301
Description: Rabbit anti Human IgA secondary antibody (Rhodamine)

Rabbit anti Human IgA (biotin)

43C-CB9118 1 mg
EUR 361
Description: Rabbit anti Human IgA secondary antibody (biotin)

Rabbit anti Human IgA (HRP)

43C-CB9119 1 mg
EUR 368
Description: Rabbit anti Human IgA secondary antibody (HRP)

pAb rabbit anti-human EPO

CT282 0.5 mg
EUR 184

Rabbit Anti-human CYP1B1 antiserum

CYP1B11-S 100 ul
EUR 457

Rabbit Anti-Human IgA Antibody

abx019263-01ml 0.1 ml
EUR 328
  • Shipped within 5-10 working days.

Rabbit Anti-Human IgM Antibody

  • EUR 258.00
  • EUR 342.00
  • 100 ul
  • 500 ul
  • Shipped within 5-10 working days.

Rabbit Anti Human IgG-Biotin

E61I00102 1mg
EUR 499

Rabbit Anti Human IgG-HRP

E61I00103 1mg
EUR 499

Rabbit Anti Human IgG-FITC

E61I00104 1mg
EUR 611

Rabbit anti-Human CD40 antiserum

CD4011-S 100 ul
EUR 457

Rabbit Anti-Human Barttin antiserum

BRTN11-S 100 ul
EUR 457

Rabbit Anti-Human IgG FC

C020221-1mg 1mg
EUR 269

Rabbit Anti-Human IgG FC

C020221-50mg 50mg
EUR 6015

Rabbit Anti-Human Endostatin antiserum

ENST11-S 100 ul
EUR 457

Rabbit Anti-Human Iceberg antiserum

ICEBERG11-S 100 ul
EUR 457

Rabbit Anti-Human Livin antiserum

LIVN11-S 100 ul
EUR 457

Rabbit Anti-Human Parkin antiserum

PARK11-S 100 ul
EUR 457

Rabbit Anti-Human Sialin antiserum

SIAL11-S 100 ul
EUR 457

Anti-CD63 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD63A-1 25 ul
EUR 219
  • Category: Exosomes

Anti-CD81 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD81A-1 25 ul
EUR 219
  • Category: Exosomes

Anti-CD9 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD9A-1 25 ul
EUR 219
  • Category: Exosomes

Anti-Hsp70 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-Hsp70A-1 25 ul
EUR 219
  • Category: Exosomes

Mouse Platelet glycoprotein Ib alpha chain, Gp1ba ELISA KIT

ELI-05549m 96 Tests
EUR 865

Mouse Platelet glycoprotein Ib alpha chain(GP1BA) ELISA kit

CSB-EL009685MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Platelet glycoprotein Ib alpha chain (GP1BA) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Platelet glycoprotein Ib alpha chain(GP1BA) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Platelet glycoprotein Ib alpha chain(GP1BA) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx359920-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx361725-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx355857-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit anti-Human GP1BA, 0.4ml