Rabbit anti-Human GP1BA, 0.4ml
Rabbit anti-Human GP1BA, 0.4ml
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
RDR-GP1Ba-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
RD-GP1Ba-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
RD-GP1Ba-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
GP1BA Rabbit pAb |
A16048-100ul |
Abclonal |
100 ul |
EUR 308 |
GP1BA Rabbit pAb |
A16048-200ul |
Abclonal |
200 ul |
EUR 459 |
GP1BA Rabbit pAb |
A16048-20ul |
Abclonal |
20 ul |
EUR 183 |
GP1BA Rabbit pAb |
A16048-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit Glycocalicin (GP1BA) ELISA Kit |
abx355223-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
GP1BA antibody |
70R-17553 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GP1BA antibody |
GP1BA Antibody |
36512-100ul |
SAB |
100ul |
EUR 252 |
GP1BA Antibody |
1-CSB-PA005629 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
GP1BA Antibody |
1-CSB-PA115108 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
GP1BA Antibody |
1-CSB-PA239383 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:100-1:300 |
GP1BA Antibody |
1-CSB-PA009685GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
GP1BA siRNA |
20-abx918305 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GP1BA siRNA |
20-abx918306 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human GP1BA shRNA Plasmid |
20-abx951878 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GP1BA Recombinant Protein (Human) |
RP013678 |
ABM |
100 ug |
Ask for price |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
GP1BA Conjugated Antibody |
C36512 |
SAB |
100ul |
EUR 397 |
GP1BA cloning plasmid |
CSB-CL009685HU-10ug |
Cusabio |
10ug |
EUR 636 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1881
- Sequence: atgcctctcctcctcttgctgctcctgctgccaagccccttacacccccaccccatctgtgaggtctccaaagtggccagccacctagaagtgaactgtgacaagaggaatctgacagcgctgcctccagacctgccgaaagacacaaccatcctccacctgagtgagaacctcc
- Show more
|
Description: A cloning plasmid for the GP1BA gene. |
Human Glycocalicin (GP1BA) ELISA Kit |
20-abx151688 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Glycocalicin (GP1BA) ELISA Kit |
abx570254-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
GP1BA ORF Vector (Human) (pORF) |
ORF004560 |
ABM |
1.0 ug DNA |
EUR 95 |
GP1BA ELISA Kit (Human) (OKAN05260) |
OKAN05260 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.3 pg/mL |
GP1BA ELISA Kit (Human) (OKAN05261) |
OKAN05261 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.35 ng/mL |
GP1BA ELISA Kit (Human) (OKCD07149) |
OKCD07149 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. GP1BA is the alpha subunit.Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.35ng/mL |
GP1BA ELISA Kit (Human) (OKCD07618) |
OKCD07618 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. GP1BA is the alpha subunit.Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 7.5pg/mL |
GP1BA ELISA Kit (Human) (OKEH01226) |
OKEH01226 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.6 pg/mL |
Mouse GP1BA shRNA Plasmid |
20-abx970610 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GP1BA Recombinant Protein (Rat) |
RP203150 |
ABM |
100 ug |
Ask for price |
GP1BA Recombinant Protein (Mouse) |
RP139199 |
ABM |
100 ug |
Ask for price |
GP1BA sgRNA CRISPR Lentivector set (Human) |
K0884601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
abx362229-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Polyclonal GP1BA(Glycocalicin) Antibody (Center) |
APR04673G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GP1BA(Glycocalicin) (Center). This antibody is tested and proven to work in the following applications: |
Chicken Glycocalicin (GP1BA) ELISA Kit |
abx354765-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Glycocalicin (GP1BA) ELISA Kit |
abx354952-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Glycocalicin (GP1BA) ELISA Kit |
abx355111-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Glycocalicin (GP1BA) ELISA Kit |
abx355358-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Gp1ba ORF Vector (Rat) (pORF) |
ORF067718 |
ABM |
1.0 ug DNA |
EUR 506 |
Gp1ba ORF Vector (Mouse) (pORF) |
ORF046401 |
ABM |
1.0 ug DNA |
EUR 506 |
GP1BA ELISA Kit (Mouse) (OKCA02430) |
OKCA02430 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: GP-Ib, a surface membrane protein of platelets, participates in the formation of platelet plugs by binding to the A1 domain of vWF, which is already bound to the subendothelium.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 11.72 pg/mL |
GP1BA ELISA Kit (Mouse) (OKEH05365) |
OKEH05365 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: GP-Ib, a surface membrane protein of platelets, participates in the formation of platelet plugs by binding to the A1 domain of vWF, which is already bound to the subendothelium.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.82 pg/mL |
Human Platelet glycoprotein Ib alpha chain (GP1BA) |
1-CSB-EP009685HU(A4) |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 83.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in E.coli |
Human Platelet glycoprotein Ib alpha chain (GP1BA) |
1-CSB-EP009685HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 57.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in E.coli |
Human Platelet glycoprotein Ib alpha chain (GP1BA) |
1-CSB-EP009685HU1 |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 15.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in E.coli |
Human Platelet glycoprotein Ib alpha chain (GP1BA) |
1-CSB-YP009685HU(A4) |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 58.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Platelet glycoprotein Ib alpha chain(GP1BA),partial expressed in Yeast |
GP1BA sgRNA CRISPR Lentivector (Human) (Target 1) |
K0884602 |
ABM |
1.0 ug DNA |
EUR 154 |
GP1BA sgRNA CRISPR Lentivector (Human) (Target 2) |
K0884603 |
ABM |
1.0 ug DNA |
EUR 154 |
GP1BA sgRNA CRISPR Lentivector (Human) (Target 3) |
K0884604 |
ABM |
1.0 ug DNA |
EUR 154 |
GP1BA Protein Vector (Human) (pPB-C-His) |
PV018237 |
ABM |
500 ng |
EUR 329 |
GP1BA Protein Vector (Human) (pPB-N-His) |
PV018238 |
ABM |
500 ng |
EUR 329 |
GP1BA Protein Vector (Human) (pPM-C-HA) |
PV018239 |
ABM |
500 ng |
EUR 329 |
GP1BA Protein Vector (Human) (pPM-C-His) |
PV018240 |
ABM |
500 ng |
EUR 329 |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Peptide |
20-abx166926 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Guinea pig Glycocalicin (GP1BA) ELISA Kit |
abx354841-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Gp1ba sgRNA CRISPR Lentivector set (Rat) |
K6723301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gp1ba sgRNA CRISPR Lentivector set (Mouse) |
K3344601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
20-abx151705 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
abx250700-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
abx251209-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human GP1BA/ Platelet glycoprotein Ib alpha chain ELISA Kit |
E1037Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Platelet glycoprotein Ib alpha chain, GP1BA ELISA KIT |
ELI-05547h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) CLIA Kit |
20-abx492424 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human) |
4-PAB108Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) |
Human Glycoprotein Ib Alpha Polypeptide, Platelet ELISA Kit (GP1Ba) |
RK01486 |
Abclonal |
96 Tests |
EUR 521 |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
SEB108Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma. |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
SEB108Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma. |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
SEB108Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma. |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
SEB108Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in Plasma. |
Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit |
4-SEB108Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Glycoprotein Ib Alpha Polypeptide, Platelet elisa. Alternative names of the recognized antigen: CD42b
- CD42-B
- CD42b-Alpha
- GP1-BA
- BSS
- GP1B
- GPIBA
- Glycocalicin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) in samples from Plasma with no significant corss-reactivity with analogues from other species. |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody |
20-abx210837 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody |
20-abx212545 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody |
20-abx112811 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody |
20-abx128759 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody |
20-abx129849 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody |
20-abx172644 |
Abbexa |
|
|
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody |
20-abx270046 |
Abbexa |
-
EUR 467.00
-
EUR 537.00
-
EUR 272.00
-
EUR 815.00
-
EUR 356.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-12 working days.
|
Platelet Glycoprotein Ib Alpha Chain (GP1BA) Antibody |
abx340135-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1BA) Antibody |
20-abx323665 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal GP1BA Antibody (monoclonal) (M02), Clone: 1C6 |
AMM03588G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human GP1BA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1C6. This antibody is applicable in WB, IP, E |
Gp1ba sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6723302 |
ABM |
1.0 ug DNA |
EUR 154 |
Gp1ba sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6723303 |
ABM |
1.0 ug DNA |
EUR 154 |
Gp1ba sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6723304 |
ABM |
1.0 ug DNA |
EUR 154 |
Gp1ba sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3344602 |
ABM |
1.0 ug DNA |
EUR 154 |
Gp1ba sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3344603 |
ABM |
1.0 ug DNA |
EUR 154 |
Gp1ba sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3344604 |
ABM |
1.0 ug DNA |
EUR 154 |
GP1BA Protein Vector (Rat) (pPB-C-His) |
PV270870 |
ABM |
500 ng |
EUR 1166 |
GP1BA Protein Vector (Rat) (pPB-N-His) |
PV270871 |
ABM |
500 ng |
EUR 1166 |
GP1BA Protein Vector (Rat) (pPM-C-HA) |
PV270872 |
ABM |
500 ng |
EUR 1166 |
GP1BA Protein Vector (Rat) (pPM-C-His) |
PV270873 |
ABM |
500 ng |
EUR 1166 |
GP1BA Protein Vector (Mouse) (pPB-C-His) |
PV185602 |
ABM |
500 ng |
EUR 1065 |
GP1BA Protein Vector (Mouse) (pPB-N-His) |
PV185603 |
ABM |
500 ng |
EUR 1065 |
GP1BA Protein Vector (Mouse) (pPM-C-HA) |
PV185604 |
ABM |
500 ng |
EUR 1065 |
GP1BA Protein Vector (Mouse) (pPM-C-His) |
PV185605 |
ABM |
500 ng |
EUR 1065 |
Recombinant Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) |
4-RPB108Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P07359
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.0kDa
- Isoelectric Point: 5.9
|
Description: Recombinant Human Glycoprotein Ib Alpha Polypeptide, Platelet expressed in: E.coli |
Recombinant Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) |
4-RPB108Mu01 |
Cloud-Clone |
-
EUR 508.58
-
EUR 239.00
-
EUR 1632.16
-
EUR 610.72
-
EUR 1121.44
-
EUR 403.00
-
EUR 3930.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35930
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Glycoprotein Ib Alpha Polypeptide, Platelet expressed in: E.coli |
Gp1ba 3'UTR Luciferase Stable Cell Line |
TU108915 |
ABM |
1.0 ml |
Ask for price |
Gp1ba 3'UTR Luciferase Stable Cell Line |
TU205275 |
ABM |
1.0 ml |
Ask for price |
Gp1ba 3'UTR GFP Stable Cell Line |
TU158915 |
ABM |
1.0 ml |
Ask for price |
Gp1ba 3'UTR GFP Stable Cell Line |
TU255275 |
ABM |
1.0 ml |
Ask for price |
GP1BA 3'UTR GFP Stable Cell Line |
TU059093 |
ABM |
1.0 ml |
EUR 1394 |
GP1BA 3'UTR Luciferase Stable Cell Line |
TU009093 |
ABM |
1.0 ml |
EUR 1394 |
Rabbit anti Human IgE |
20-IR77 |
Fitzgerald |
1 ml |
EUR 192 |
Description: Rabbit anti Human IgE antibody |
Rabbit anti Human IgG |
40C-CB0943 |
Fitzgerald |
1 mg |
EUR 249 |
Description: Rabbit anti Human IgG secondary antibody |
Rabbit anti Human IgG |
40C-CB0950 |
Fitzgerald |
5 mg |
EUR 381 |
Description: Rabbit anti Human IgG secondary antibody |
Rabbit anti Human IgG |
40C-CB0971 |
Fitzgerald |
2 mg |
EUR 322 |
Description: Rabbit anti Human IgG secondary antibody |
Rabbit anti Human IgM |
40C-CB9100 |
Fitzgerald |
2 mg |
EUR 283 |
Description: Rabbit anti Human IgM secondary antibody |
Rabbit anti Human IgA |
40C-CB9114 |
Fitzgerald |
2 mg |
EUR 259 |
Description: Rabbit anti Human IgA secondary antibody |
Rabbit Anti Human IgG |
E61I00101 |
EnoGene |
100ug |
EUR 343 |
ELISA kit for Human GP1Ba (Glycoprotein Ib Alpha Polypeptide, Platelet) |
ELK4501 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycoprotein Ib Alpha Polypeptide, Platelet (GP1B?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant
- Show more
|
Description: A sandwich ELISA kit for detection of Glycoprotein Ib Alpha Polypeptide, Platelet from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0884605 |
ABM |
3 x 1.0 ug |
EUR 376 |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), APC |
4-PAB108Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with APC. |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), Biotinylated |
4-PAB108Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with Biotin. |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), Cy3 |
4-PAB108Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with Cy3. |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), FITC |
4-PAB108Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with FITC. |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), HRP |
4-PAB108Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with HRP. |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), PE |
4-PAB108Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with PE. |
Mouse Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Peptide |
20-abx168432 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2193.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody (FITC) |
20-abx270344 |
Abbexa |
-
EUR 523.00
-
EUR 606.00
-
EUR 300.00
-
EUR 940.00
-
EUR 384.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-12 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody (APC) |
20-abx270576 |
Abbexa |
-
EUR 704.00
-
EUR 829.00
-
EUR 370.00
-
EUR 1330.00
-
EUR 495.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-12 working days.
|
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Antibody (PE) |
20-abx270808 |
Abbexa |
-
EUR 606.00
-
EUR 718.00
-
EUR 328.00
-
EUR 1135.00
-
EUR 439.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-12 working days.
|
GP1BA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV647485 |
ABM |
1.0 ug DNA |
EUR 1355 |
GP1BA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV647489 |
ABM |
1.0 ug DNA |
EUR 1355 |
GP1BA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV647490 |
ABM |
1.0 ug DNA |
EUR 1355 |
GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0884606 |
ABM |
1.0 ug DNA |
EUR 167 |
GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0884607 |
ABM |
1.0 ug DNA |
EUR 167 |
GP1BA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0884608 |
ABM |
1.0 ug DNA |
EUR 167 |
Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB108Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GP1Ba (Ile19~Leu291)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba). This antibody is labeled with APC-Cy7. |
Rabbit anti Human IgG (FITC) |
43C-CB0944 |
Fitzgerald |
1 mg |
EUR 311 |
Description: Rabbit anti Human IgG secondary antibody (FITC) |
Rabbit anti Human IgG (rhodamine) |
43C-CB0945 |
Fitzgerald |
1 mg |
EUR 348 |
Description: Rabbit anti Human IgG secondary antibody (Rhodamine) |
Rabbit anti Human IgG (biotin) |
43C-CB0947 |
Fitzgerald |
1 mg |
EUR 340 |
Description: Rabbit anti Human IgG secondary antibody (biotin) |
Rabbit anti Human IgG (HRP) |
43C-CB0948 |
Fitzgerald |
1 mg |
EUR 417 |
Description: Rabbit anti Human IgG secondary antibody (HRP) |
Rabbit anti Human IgG (FITC) |
43C-CB0951 |
Fitzgerald |
2 mg |
EUR 273 |
Description: Rabbit anti Human IgG secondary antibody (FITC) |
Rabbit anti Human IgG (rhodamine) |
43C-CB0952 |
Fitzgerald |
2 mg |
EUR 278 |
Description: Rabbit anti Human IgG secondary antibody (Rhodamine) |
Rabbit anti Human IgG (biotin) |
43C-CB0954 |
Fitzgerald |
2 mg |
EUR 340 |
Description: Rabbit anti Human IgG secondary antibody (biotin) |
Rabbit anti Human IgG (HRP) |
43C-CB0955 |
Fitzgerald |
2 mg |
EUR 361 |
Description: Rabbit anti Human IgG secondary antibody (HRP) |
Rabbit anti Human IgG (FITC) |
43C-CB0965 |
Fitzgerald |
2 mg |
EUR 291 |
Description: Rabbit anti Human IgG secondary antibody (FITC) |
Rabbit anti Human IgG (rhodamine) |
43C-CB0966 |
Fitzgerald |
2 mg |
EUR 291 |
Description: Rabbit anti Human IgG secondary antibody (Rhodamine) |
Rabbit anti Human IgG (biotin) |
43C-CB0968 |
Fitzgerald |
2 mg |
EUR 359 |
Description: Rabbit anti Human IgG secondary antibody (biotin) |
Rabbit anti Human IgG (HRP) |
43C-CB0969 |
Fitzgerald |
2 mg |
EUR 369 |
Description: Rabbit anti Human IgG secondary antibody (HRP) |
Rabbit anti Human IgM (FITC) |
43C-CB9101 |
Fitzgerald |
1.5 mg |
EUR 315 |
Description: Rabbit anti Human IgM secondary antibody (FITC) |
Rabbit anti Human IgM (rhodamine) |
43C-CB9102 |
Fitzgerald |
1.5 mg |
EUR 302 |
Description: Rabbit anti Human IgM secondary antibody (Rhodamine) |
Rabbit anti Human IgM (biotin) |
43C-CB9104 |
Fitzgerald |
1.5 mg |
EUR 357 |
Description: Rabbit anti Human IgM secondary antibody (biotin) |
Rabbit anti Human IgM (HRP) |
43C-CB9105 |
Fitzgerald |
1.5 mg |
EUR 392 |
Description: Rabbit anti Human IgM secondary antibody (HRP) |
Rabbit anti Human IgA (FITC) |
43C-CB9115 |
Fitzgerald |
1 mg |
EUR 294 |
Description: Rabbit anti Human IgA secondary antibody (FITC) |
Rabbit anti Human IgA (rhodamine) |
43C-CB9116 |
Fitzgerald |
1 mg |
EUR 301 |
Description: Rabbit anti Human IgA secondary antibody (Rhodamine) |
Rabbit anti Human IgA (biotin) |
43C-CB9118 |
Fitzgerald |
1 mg |
EUR 361 |
Description: Rabbit anti Human IgA secondary antibody (biotin) |
Rabbit anti Human IgA (HRP) |
43C-CB9119 |
Fitzgerald |
1 mg |
EUR 368 |
Description: Rabbit anti Human IgA secondary antibody (HRP) |
pAb rabbit anti-human EPO |
CT282 |
U-CyTech |
0.5 mg |
EUR 184 |
Rabbit Anti-Human IgA Antibody |
abx019263-01ml |
Abbexa |
0.1 ml |
EUR 328 |
- Shipped within 5-10 working days.
|
Rabbit Anti-Human IgM Antibody |
20-abx134798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Anti Human IgG-Biotin |
E61I00102 |
EnoGene |
1mg |
EUR 499 |
Rabbit Anti Human IgG-HRP |
E61I00103 |
EnoGene |
1mg |
EUR 499 |
Rabbit Anti Human IgG-FITC |
E61I00104 |
EnoGene |
1mg |
EUR 611 |
Rabbit Anti-Human IgG FC |
C020221-1mg |
Unibiotest |
1mg |
EUR 269 |
Rabbit Anti-Human IgG FC |
C020221-50mg |
Unibiotest |
50mg |
EUR 6015 |
Anti-CD63 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-CD63A-1 |
SBI |
25 ul |
EUR 219 |
|
Anti-CD81 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-CD81A-1 |
SBI |
25 ul |
EUR 219 |
|
Anti-CD9 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-CD9A-1 |
SBI |
25 ul |
EUR 219 |
|
Anti-Hsp70 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-Hsp70A-1 |
SBI |
25 ul |
EUR 219 |
|
Mouse Platelet glycoprotein Ib alpha chain, Gp1ba ELISA KIT |
ELI-05549m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Platelet glycoprotein Ib alpha chain(GP1BA) ELISA kit |
CSB-EL009685MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Platelet glycoprotein Ib alpha chain (GP1BA) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Platelet glycoprotein Ib alpha chain(GP1BA) ELISA kit |
1-CSB-EL009685MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Platelet glycoprotein Ib alpha chain(GP1BA) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Monkey Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
abx359920-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
abx361725-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit |
abx355857-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit anti-Human GP1BA, 0.4ml