Porcine HMGB1 ELISA Kit

Porcine HMGB1 ELISA Kit 

To Order Contact us: caitlyn@ucb-bioproducts.com


ELA-E0399h 96 Tests
EUR 824


EHH0016 96Tests
EUR 521


EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit

EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit

ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit

ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit

EAH0016 96Tests
EUR 521


EF000598 96 Tests
EUR 689


ERH0016 96Tests
EUR 521


ESH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit

ERTH0016 96Tests
EUR 521


EMH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit

EMKH0016 96Tests
EUR 521


STJ150371 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids


STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids


STJ150484 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Mouse serum, plasma and other biological fluids

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Guinea Pig HMGB1 ELISA Kit

EGH0016 96Tests
EUR 521

HMGB1 ELISA Kit (Rat) (OKAN06040)

OKAN06040 96 Wells
EUR 792
Description: Description of target: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06342)

OKAN06342 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06343)

OKAN06343 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL

HMGB1 ELISA Kit (Mouse) (OKAN06405)

OKAN06405 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL

HMGB1 ELISA Kit (Dog) (OKCA02054)

OKCA02054 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

HMGB1 ELISA Kit (Mouse) (OKCD04072)

OKCD04072 96 Wells
EUR 779
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL

HMGB1 ELISA Kit (Rat) (OKCD04073)

OKCD04073 96 Wells
EUR 818
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKCD04074)

OKCD04074 96 Wells
EUR 753
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Pig) (OKEH07385)

OKEH07385 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059ng/mL

HMGB1 ELISA Kit (Rabbit) (OKWB00408)

OKWB00408 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Rabbit;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

HMGB1 ELISA Kit (Chicken) (OKEH03961)

OKEH03961 96 Wells
EUR 844
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. Nuclear functions are attributed to fully reduced HGMB1. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA, DNA-containing cruciforms or bent structures, supercoiled DNA and ZDNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters. Can restructure the canonical nucleosome. Proposed to be an universal biosensor for nucleic acids. May promote inflammatory response to sterile and infectious signals and may be involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm may function as sensor and/or chaperone for immunogenic nucleic acids, and mediate autophagy. May act as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

HMGB1 ELISA Kit (Pig | Swine) (OKCA02201)

OKCA02201 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Pig | Swine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL.

HMGB1 protein

30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody

70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

EUR 452

HMGB1 Antibody

33661-100ul 100ul
EUR 252

HMGB1 Antibody

33661-50ul 50ul
EUR 187

HMGB1 antibody

38424-100ul 100ul
EUR 252

HMGB1 antibody

10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 Antibody

48606-100ul 100ul
EUR 333

HMGB1 Antibody

48606-50ul 50ul
EUR 239

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody

DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Bovine HMGB1

9050 1 mg/ml x 0.1 ml
EUR 309.55
Description: Bovine HMGB1

HMGB1 Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HMGB1 Antibody

AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Protein

  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody

ABF7020 100 ug
EUR 438

HMGB1 Antibody

ABD3077 100 ug
EUR 438

HMGB1 Antibody

ABD7008 100 ug
EUR 438


PVT10093 2 ug
EUR 266

HMGB1 Plasmid

PVT7114 2 ug
EUR 266


YF-PA12378 100 ul
EUR 403
Description: Rabbit polyclonal to HMGB1


YF-PA23886 50 ul
EUR 334
Description: Mouse polyclonal to HMGB1

HMGB1, human

RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

HMGB1 Chemi-Luminescent ELISA Kit (Human) (OKCD03560)

OKCD03560 96 Wells
EUR 988
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury . Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance . Has proangiogdenic activity . May be involved in platelet activation . Binds to phosphatidylserine and phosphatidylethanolamide . Bound to RAGE mediates signaling for neuronal outgrowth . May play a role in accumulation of expanded polyglutamine (polyQ) proteins such as huntingtin (HTT) or TBP .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.7 pg/mL

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

[One Step] HMGB1 antibody Kit

RK05718 50 ul
EUR 240

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

HMGB1 protein (Mouse)

30R-2278 100 ug
EUR 2012
Description: Purified recombinant Mouse HMGB1 protein

HMGB1 Rabbit pAb

A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb

A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb

A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb

A0718-50ul 50 ul Ask for price

HMGB1 antibody (HRP)

60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)

60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)

60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)

HMGB1 Blocking Peptide

DF3077-BP 1mg
EUR 195

HMGB1 Blocking Peptide

DF7008-BP 1mg
EUR 195

HMGB1 Polyclonal Antibody

A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

Anti-HMGB1 Antibody

A00066-1 100ug/vial
EUR 334

HMGB1 (AcK12) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


E21-357 10ug
EUR 343

HMGB1 Conjugated Antibody

C48606 100ul
EUR 397

HMGB1 Blocking Peptide

AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody

C33661 100ul
EUR 397

HMGB1 cloning plasmid

CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 Polyclonal Antibody

A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- HMGB1 antibody

FNab10218 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: High mobility group protein B1
  • Uniprot ID: P09429
  • Gene ID: 3146
Description: Antibody raised against HMGB1

anti- HMGB1 antibody

FNab03924 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: high-mobility group box 1
  • Uniprot ID: P09429
  • Gene ID: 3146
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HMGB1

Porcine HMGB1 ELISA Kit