Porcine HMGB1 ELISA Kit

Porcine HMGB1 ELISA Kit 

To Order Contact us: caitlyn@ucb-bioproducts.com


ELA-E0399h 96 Tests
EUR 824


EHH0016 96Tests
EUR 521


EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit

EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit

ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit

ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit

EAH0016 96Tests
EUR 521


EF000598 96 Tests
EUR 689


ERH0016 96Tests
EUR 521


ESH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit

ERTH0016 96Tests
EUR 521


EMH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit

EMKH0016 96Tests
EUR 521


STJ150371 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids


STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids


STJ150484 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Mouse serum, plasma and other biological fluids

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Guinea Pig HMGB1 ELISA Kit

EGH0016 96Tests
EUR 521

HMGB1 ELISA Kit (Rat) (OKAN06040)

OKAN06040 96 Wells
EUR 792
Description: Description of target: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06342)

OKAN06342 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06343)

OKAN06343 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL

HMGB1 ELISA Kit (Mouse) (OKAN06405)

OKAN06405 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL

HMGB1 ELISA Kit (Dog) (OKCA02054)

OKCA02054 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

HMGB1 ELISA Kit (Mouse) (OKCD04072)

OKCD04072 96 Wells
EUR 779
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL

HMGB1 ELISA Kit (Rat) (OKCD04073)

OKCD04073 96 Wells
EUR 818
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKCD04074)

OKCD04074 96 Wells
EUR 753
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Pig) (OKEH07385)

OKEH07385 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059ng/mL

HMGB1 ELISA Kit (Rabbit) (OKWB00408)

OKWB00408 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Rabbit;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

HMGB1 ELISA Kit (Chicken) (OKEH03961)

OKEH03961 96 Wells
EUR 844
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. Nuclear functions are attributed to fully reduced HGMB1. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA, DNA-containing cruciforms or bent structures, supercoiled DNA and ZDNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters. Can restructure the canonical nucleosome. Proposed to be an universal biosensor for nucleic acids. May promote inflammatory response to sterile and infectious signals and may be involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm may function as sensor and/or chaperone for immunogenic nucleic acids, and mediate autophagy. May act as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

HMGB1 ELISA Kit (Pig | Swine) (OKCA02201)

OKCA02201 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Pig | Swine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL.

HMGB1 protein

30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody

70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

EUR 452

HMGB1 Antibody

33661-100ul 100ul
EUR 252

HMGB1 Antibody

33661-50ul 50ul
EUR 187

HMGB1 antibody

38424-100ul 100ul
EUR 252

HMGB1 antibody

10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 Antibody

48606-100ul 100ul
EUR 333

HMGB1 Antibody

48606-50ul 50ul
EUR 239

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody

DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Bovine HMGB1

9050 1 mg/ml x 0.1 ml
EUR 309.55
Description: Bovine HMGB1

HMGB1 Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HMGB1 Antibody

AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Protein

  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody

ABF7020 100 ug
EUR 438

HMGB1 Antibody

ABD3077 100 ug
EUR 438

HMGB1 Antibody

ABD7008 100 ug
EUR 438


PVT10093 2 ug
EUR 266

HMGB1 Plasmid

PVT7114 2 ug
EUR 266


YF-PA12378 100 ul
EUR 403
Description: Rabbit polyclonal to HMGB1


YF-PA23886 50 ul
EUR 334
Description: Mouse polyclonal to HMGB1

HMGB1, human

RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

HMGB1 Chemi-Luminescent ELISA Kit (Human) (OKCD03560)

OKCD03560 96 Wells
EUR 988
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury . Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance . Has proangiogdenic activity . May be involved in platelet activation . Binds to phosphatidylserine and phosphatidylethanolamide . Bound to RAGE mediates signaling for neuronal outgrowth . May play a role in accumulation of expanded polyglutamine (polyQ) proteins such as huntingtin (HTT) or TBP .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.7 pg/mL

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

[One Step] HMGB1 antibody Kit

RK05718 50 ul
EUR 240

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

HMGB1 protein (Mouse)

30R-2278 100 ug
EUR 2012
Description: Purified recombinant Mouse HMGB1 protein

HMGB1 Rabbit pAb

A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb

A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb

A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb

A0718-50ul 50 ul Ask for price

HMGB1 antibody (HRP)

60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)

60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)

60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)

HMGB1 Blocking Peptide

DF3077-BP 1mg
EUR 195

HMGB1 Blocking Peptide

DF7008-BP 1mg
EUR 195

HMGB1 Polyclonal Antibody

A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

Anti-HMGB1 Antibody

A00066-1 100ug/vial
EUR 334

HMGB1 (AcK12) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


E21-357 10ug
EUR 343

HMGB1 Conjugated Antibody

C48606 100ul
EUR 397

HMGB1 Blocking Peptide

AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody

C33661 100ul
EUR 397

HMGB1 cloning plasmid

CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 Polyclonal Antibody

A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- HMGB1 antibody

FNab10218 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: High mobility group protein B1
  • Uniprot ID: P09429
  • Gene ID: 3146
Description: Antibody raised against HMGB1

anti- HMGB1 antibody

FNab03924 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: high-mobility group box 1
  • Uniprot ID: P09429
  • Gene ID: 3146
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HMGB1

Anti-HMGB1 antibody

PAab03924 100 ug
EUR 355

Recombinant Human HMGB1

P0194 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09429
Description: Recombinant Human protein for HMGB1

pShuttle- CMV- HMGB1

PVT10158 2 ug
EUR 301

pcDNA3.1(+)-HMGB1 Plasmid

PVTB50051-2a 2 ug
EUR 356


PVT18174 2 ug
EUR 231

pET28a-HMGB1 Plasmid

PVTB00031-1a 2 ug
EUR 356

Anti-HMGB1 antibody

STJ24037 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ24039 100 µl
EUR 413
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ29816 100 µl
EUR 457
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 Antibody

STJ501358 100 µg
EUR 476

Anti-HMGB1 (1D5)

YF-MA10425 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B11)

YF-MA10426 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (2F6)

YF-MA10427 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B2)

YF-MA13482 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D10)

YF-MA13483 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D9)

YF-MA13484 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Porcine Oxytocin ELISA kit

55R-2031 96 tests
EUR 617
Description: ELISA Kit for detection of Oxytocin in the research laboratory

Porcine Leptin ELISA kit

55R-2032 96 tests
EUR 617
Description: ELISA Kit for detection of Leptin in the research laboratory

Porcine E2 ELISA kit

55R-2113 96 tests
EUR 739
Description: ELISA Kit for detection of E2 in the research laboratory

Porcine IL12 ELISA kit

55R-2154 96 tests
EUR 766
Description: ELISA Kit for detection of IL12 in the research laboratory

Porcine IL18 ELISA kit

55R-2155 96 tests
EUR 766
Description: ELISA Kit for detection of IL18 in the research laboratory

Porcine IL4 ELISA kit

55R-2156 96 tests
EUR 766
Description: ELISA Kit for detection of IL4 in the research laboratory

Porcine IL8 ELISA kit

55R-2157 96 tests
EUR 766
Description: ELISA Kit for detection of IL8 in the research laboratory

Porcine MMP2 ELISA kit

55R-2158 96 tests
EUR 766
Description: ELISA Kit for detection of MMP2 in the research laboratory

Porcine IL17 ELISA kit

55R-2213 96 tests
EUR 766
Description: ELISA Kit for detection of IL17 in the research laboratory

Porcine Erythropoietin ELISA Kit

ELA-E0028p 96 Tests
EUR 928

Porcine Laminin ELISA Kit

ELA-E0082p 96 Tests
EUR 928

Porcine Leptin ELISA Kit

ELA-E0084p 96 Tests
EUR 928

Porcine Prednisolone ELISA Kit

ELA-E0231p 96 Tests
EUR 928

Porcine Methemoglobin ELISA Kit

ELA-E0286p 96 Tests
EUR 928

Porcine Proinsulin ELISA Kit

ELA-E0379p 96 Tests
EUR 928

Porcine Inhibin ELISA Kit

ELA-E0446p 96 Tests
EUR 928

Porcine Insulin ELISA Kit

ELA-E0448p 96 Tests
EUR 928

Porcine Testoterone ELISA Kit

ELA-E0458p 96 Tests
EUR 928

Porcine Progesterone ELISA Kit

ELA-E0459p 96 Tests
EUR 928

Porcine Estradiol ELISA Kit

ELA-E0461p 96 Tests
EUR 928

Porcine Cortisol ELISA Kit

ELA-E0462p 96 Tests
EUR 928

Porcine thrombomodulin ELISA Kit

ELA-E0529p 96 Tests
EUR 928

Porcine Corticosterone ELISA Kit

ELA-E0540p 96 Tests
EUR 928

Porcine telomerase ELISA Kit

ELA-E0558p 96 Tests
EUR 928

Porcine Somatostatin ELISA Kit

ELA-E0592p 96 Tests
EUR 928

Porcine Fibrinogen ELISA Kit

ELA-E0595p 96 Tests
EUR 928

Porcine myeloperoxidase ELISA Kit

ELA-E0601p 96 Tests
EUR 928

Porcine Hydroxyproline ELISA Kit

ELA-E0621p 96 Tests
EUR 928

Porcine 8OHDG ELISA Kit

ELA-E0660p 96 Tests
EUR 928

Porcine Estrogen ELISA Kit

ELA-E0696p 96 Tests
EUR 928

Porcine cholecystokinin ELISA Kit

ELA-E0802p 96 Tests
EUR 928

Porcine prolactin ELISA Kit

ELA-E0846p 96 Tests
EUR 928

Porcine Resistin ELISA Kit

ELA-E0847p 96 Tests
EUR 928

Porcine Noradrenaline ELISA Kit

ELA-E0907p 96 Tests
EUR 928

Porcine Melatonin ELISA Kit

ELA-E0908p 96 Tests
EUR 928

Porcine acetylcholine ELISA Kit

ELA-E0912p 96 Tests
EUR 928

Porcine Histamine ELISA kit

ELA-E0927p 96 Tests
EUR 928

Porcine chemerin ELISA Kit

ELA-E0945p 96 Tests
EUR 928

Porcine Relaxin ELISA Kit

ELA-E1216p 96 Tests
EUR 928

Porcine Glucagon ELISA Kit

ELA-E1266p 96 Tests
EUR 928

Porcine Asprosin ELISA Kit

ELA-E15190p 96 Tests
EUR 928

Porcine Ferroportin ELISA Kit

ELA-E9698p 96 Tests
EUR 928


ELI-04357p 96 Tests
EUR 928


ELI-05384p 96 Tests
EUR 928


ELI-26613p 96 Tests
EUR 928

Obestatin ELISA Kit| Porcine

EF016751 96 Tests
EUR 689

Porcine Biopterin ELISA Kit

CELI-66011p 96 Tests
EUR 928

Porcine Calcitriol ELISA Kit

CELI-66118p 96 Tests
EUR 928

Porcine IL1RA ELISA Kit

EPI0322 96Tests
EUR 521

Porcine IAPP ELISA Kit

EPI0328 96Tests
EUR 521

Porcine ICA ELISA Kit

EPI0329 96Tests
EUR 521

Porcine ICD ELISA Kit

EPI0337 96Tests
EUR 521

Porcine ICTP ELISA Kit

EPI0338 96Tests
EUR 521

Porcine IDE ELISA Kit

EPI0339 96Tests
EUR 521

Porcine IDS ELISA Kit

EPI0341 96Tests
EUR 521

Porcine HMGB1 ELISA Kit