pGreenFire1-TCF/LEF1 (plasmid)

pGreenFire1-TCF/LEF1 (plasmid) 

To Order Contact us: caitlyn@ucb-bioproducts.com

pGreenFire1-TCF/LEF1 (plasmid)+ EF1-Neo

TR013PA-N 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-TCF/LEF1 (plasmid)+ EF1-Puro

TR013PA-P 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-TCF/LEF1 (virus) + EF1-Neo

TR013VA-N >2 x 10^6 IFUs
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-TCF/LEF1 (virus) + EF1-Puro

TR013VA-P >2 x 10^6 IFUs
EUR 786
  • Category: Lentiviral Technology

LEF1 cloning plasmid

CSB-CL012856HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atgccccaactctccggaggaggtggcggcggcgggggggacccggaactctgcgccacggacgagatgatccccttcaaggacgagggcgatcctcagaaggaaaagatcttcgccgagatcagtcatcccgaagaggaaggcgatttagctgacatcaagtcttccttggtga
  • Show more
Description: A cloning plasmid for the LEF1 gene.

pGreenFire1-STAT1 (plasmid)

TR015PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-ISRE (plasmid)

TR016PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-Gal4 (plasmid)

TR017PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-Nanog (plasmid)

TR019PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-Notch (plasmid)

TR020PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-HIF1 (plasmid)

TR026PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-GAS (plasmid)

TR027PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-SREBP (plasmid)

TR028PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-SRF (plasmid)

TR029PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-MEF2 (plasmid)

TR030PA-1 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-TCF/LEF1 (plasmid)