Mouse anti-human IGJ

Mouse anti-human IGJ 

To Order Contact us: caitlyn@ucb-bioproducts.com

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Mouse IGJ shRNA Plasmid
20-abx970998	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IGJ Recombinant Protein (Mouse)
RP143243	ABM	100 ug	Ask for price

IGJ siRNA
20-abx920335	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IGJ siRNA
20-abx920336	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IGJ antibody
10R-6990	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6992	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6994	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6995	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-4454	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-4455	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-4456	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IGJ antibody

Human IGJ ELISA Kit
ELA-E0643h	Lifescience Market	96 Tests	EUR 824

IGJ ELISA KIT|Human
EF000679	Lifescience Market	96 Tests	EUR 689

Human IGJ shRNA Plasmid
20-abx952364	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IGJ Recombinant Protein (Human)
RP015793	ABM	100 ug	Ask for price

Mouse Immunoglobulin J chain (Igj)
1-CSB-YP011337MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 17.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Immunoglobulin J chain(Igj) expressed in Yeast

Igj ORF Vector (Mouse) (pORF)
ORF047749	ABM	1.0 ug DNA	EUR 506

Rabbit Anti-Human IGJ Polyclonal Antibody(Pre-diluted)
CPBT-36213RH	Creative Diagnostics	7ml	EUR 991

IGJ cloning plasmid
CSB-CL011337HU-10ug	Cusabio	10ug	EUR 244
Formulation: 10 μg plasmid + 200μl Glycerol Length: 480 Sequence: atgaagaaccatttgcttttctggggagtcctggcggtttttattaaggctgttcatgtgaaagcccaagaagatgaaaggattgttcttgttgacaacaaatgtaagtgtgcccggattacttccaggatcatccgttcttccgaagatcctaatgaggacattgtggagagaaa Show more
Description: A cloning plasmid for the IGJ gene.

IGJ ORF Vector (Human) (pORF)
ORF005265	ABM	1.0 ug DNA	EUR 95

Igj sgRNA CRISPR Lentivector set (Mouse)
K3363801	ABM	3 x 1.0 ug	EUR 339

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

IGJ protein (His tag)
80R-2743	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant IGJ protein (His tag)

Human Immunoglobulin J Chain (IGJ) Antibody
30165-05111	AssayPro	150 ug	EUR 261

IGJ sgRNA CRISPR Lentivector set (Human)
K1049501	ABM	3 x 1.0 ug	EUR 339

IGJ Immunoglobulin J Human Recombinant Protein
PROTP01591	BosterBio	Regular: 20ug	EUR 317
Description: IGJ Human Recombinant produced in E. coli is a single polypeptide chain containing 160 amino acids (23-159) and having a molecular mass of 18kDa. IGJ is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Immunoglobulin J chain, Igj ELISA KIT
ELI-02274m	Lifescience Market	96 Tests	EUR 865

Igj sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3363802	ABM	1.0 ug DNA	EUR 154

Igj sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3363803	ABM	1.0 ug DNA	EUR 154

Igj sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3363804	ABM	1.0 ug DNA	EUR 154

IGJ Protein Vector (Mouse) (pPB-C-His)
PV190994	ABM	500 ng	EUR 603

IGJ Protein Vector (Mouse) (pPB-N-His)
PV190995	ABM	500 ng	EUR 603

IGJ Protein Vector (Mouse) (pPM-C-HA)
PV190996	ABM	500 ng	EUR 603

IGJ Protein Vector (Mouse) (pPM-C-His)
PV190997	ABM	500 ng	EUR 603

Immunoglobulin J Chain (IGJ) Antibody
abx234187-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Human IGJ(Immunoglobulin J chain) ELISA Kit
EH0989	FN Test	96T	EUR 567.6
Detection range: 1.56-100 ng/ml Uniprot ID: P01591 Alias: IGJ/Immunoglobulin J chain/IGCJ
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Immunoglobulin J chain, IGJ ELISA KIT
ELI-02275h	Lifescience Market	96 Tests	EUR 824

IGJ sgRNA CRISPR Lentivector (Human) (Target 1)
K1049502	ABM	1.0 ug DNA	EUR 154

IGJ sgRNA CRISPR Lentivector (Human) (Target 2)
K1049503	ABM	1.0 ug DNA	EUR 154

IGJ sgRNA CRISPR Lentivector (Human) (Target 3)
K1049504	ABM	1.0 ug DNA	EUR 154

Human Immunoglobulin J chain(IGJ) ELISA kit
CSB-E09237h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Immunoglobulin J chain (IGJ) in samples from serum, plasma, saliva, urine, tear, breastmilk. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Immunoglobulin J chain(IGJ) ELISA kit
1-CSB-E09237h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Immunoglobulin J chain(IGJ) in samples from serum, plasma, saliva, urine, tear, breastmilk. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Recombinant Human IGJ Protein, His, E.coli-1mg
QP12387-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human IGJ Protein, His, E.coli-20ug
QP12387-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human IGJ Protein, His, E.coli-5ug
QP12387-5ug	EnQuireBio	5ug	EUR 155

IGJ Protein Vector (Human) (pPB-C-His)
PV021057	ABM	500 ng	EUR 329

IGJ Protein Vector (Human) (pPB-N-His)
PV021058	ABM	500 ng	EUR 329

IGJ Protein Vector (Human) (pPM-C-HA)
PV021059	ABM	500 ng	EUR 329

IGJ Protein Vector (Human) (pPM-C-His)
PV021060	ABM	500 ng	EUR 329

Mouse Immunoglobulin J chain / IGJ (JCHAIN) ELISA Kit
abx513597-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Immunoglobulin J Chain (IGJ) AssayMax ELISA Kit
EI1701-1	AssayPro	96 Well Plate	EUR 417

Human Immunoglobulin J chain / IGJ (JCHAIN) ELISA Kit
abx253943-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Immunoglobulin J Chain (IGJ) Antibody (Biotin Conjugate)
30165-05121	AssayPro	150 ug	EUR 369

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC Conjugate)
30165-05141	AssayPro	150 ug	EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (RPE Conjugate)
30165-05151	AssayPro	150 ug	EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (APC Conjugate)
30165-05161	AssayPro	150 ug	EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (PerCP Conjugate)
30165-05171	AssayPro	150 ug	EUR 471

Rabbit Immunoglobulin J chain, IGJ ELISA KIT
ELI-02276Ra	Lifescience Market	96 Tests	EUR 928

Igj 3'UTR GFP Stable Cell Line
TU159977	ABM	1.0 ml	Ask for price

IGJ 3'UTR Luciferase Stable Cell Line
TU010769	ABM	1.0 ml	EUR 1394

Igj 3'UTR Luciferase Stable Cell Line
TU109977	ABM	1.0 ml	Ask for price

IGJ 3'UTR GFP Stable Cell Line
TU060769	ABM	1.0 ml	EUR 1394

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3363805	ABM	3 x 1.0 ug	EUR 376

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1049505	ABM	3 x 1.0 ug	EUR 376

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3363806	ABM	1.0 ug DNA	EUR 167

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3363807	ABM	1.0 ug DNA	EUR 167

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3363808	ABM	1.0 ug DNA	EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1049506	ABM	1.0 ug DNA	EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1049507	ABM	1.0 ug DNA	EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1049508	ABM	1.0 ug DNA	EUR 167

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)
30165-05181	AssayPro	1 x 75 ug, 3 x 30 ug	EUR 585

Human Immunoglobulin J Chain (IGJ) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit
FACS30165M	AssayPro	Kit	EUR 693

Mouse Anti Human IgM
E61I00402	EnoGene	100ug	EUR 343

Mouse anti human IgA
E61I02101	EnoGene	100ug	EUR 343

Mouse anti human IgE
E61I02201	EnoGene	100ug	EUR 343

Mouse anti Human IgM
41R-1586	Fitzgerald	100 ug	EUR 265
Description: Monoclonal Mouse anti Human IgM antibody

Mouse anti Human IgE
40R-1000	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgA
40R-1001	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgA antibody

Mouse anti Human IgG
40R-1003	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgG antibody

Mouse anti Human IgE
40R-1004	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgM
40R-1005	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA
40R-1006	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgA antibody

Mouse anti Human IgA
40R-1011	Fitzgerald	500 ug	EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgA
40R-1012	Fitzgerald	500 ug	EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgG3
40R-1015	Fitzgerald	1 mg	EUR 414
Description: Mouse anti Human IgG3 antibody

Mouse anti Human IgM
10C-CR2023M2	Fitzgerald	1 mg	EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10C-CR2023M3	Fitzgerald	1 mg	EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA
10C-CR6043M1	Fitzgerald	1 mg	EUR 241
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE
10C-CR6046M3	Fitzgerald	1 mg	EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10C-CR6046M4	Fitzgerald	1 mg	EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10C-CR6046M5	Fitzgerald	1 mg	EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG
10C-CR6047M1	Fitzgerald	1 mg	EUR 176
Description: Mouse anti Human IgG antibody

Mouse anti Human IgG
10C-CR6047M2	Fitzgerald	1 mg	EUR 176
Description: Mouse anti Human IgG antibody

Mouse anti Human IgA
10-7808	Fitzgerald	1 mg	EUR 336
Description: Mouse anti Human IgA antibody

Mouse anti Human IgA
10-I05A	Fitzgerald	1 mg	EUR 308
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE
10-I104B	Fitzgerald	1 mg	EUR 336
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10-I104CC	Fitzgerald	1 mg	EUR 336
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10-I10A	Fitzgerald	1 mg	EUR 181
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10-I10C	Fitzgerald	1 mg	EUR 181
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10-I10E	Fitzgerald	1 mg	EUR 495
Description: Mouse anti Human IgE antibody

Mouse anti Human IgM
10-I20A	Fitzgerald	1 mg	EUR 191
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10-I20B	Fitzgerald	1 mg	EUR 295
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10-I20G	Fitzgerald	1 mg	EUR 295
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10-I20H	Fitzgerald	1 mg	EUR 187
Description: Mouse anti Human IgM antibody

Mouse anti Human IgG1
10-I21A	Fitzgerald	200 ug	EUR 220
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG2
10-I22A	Fitzgerald	200 ug	EUR 392
Description: Mouse anti Human IgG2 antibody

Mouse anti Human IgG3
10-I23A	Fitzgerald	200 ug	EUR 635
Description: Mouse anti Human IgG3 antibody

Mouse anti Human IgG4
10-I24A	Fitzgerald	200 ug	EUR 392
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgE
10-S9601MND1-M0	Fitzgerald	1 mg	EUR 219
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10-1025	Fitzgerald	1 mg	EUR 327
Description: Mouse monoclonal Mouse anti Human IgE antibody

Mouse anti Human IgE
10-1026	Fitzgerald	1 mg	EUR 327
Description: Mouse monoclonal Mouse anti Human IgE antibody

Mouse anti Human IgE
10-1027	Fitzgerald	1 mg	EUR 327
Description: Mouse monoclonal Mouse anti Human IgE antibody

Mouse anti Human IgE
10R-I104d	Fitzgerald	1 mg	EUR 447
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10R-I104e	Fitzgerald	1 mg	EUR 489
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG1
10R-I110a	Fitzgerald	1 ml	EUR 554
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG1
10R-I127a	Fitzgerald	1 mg	EUR 489
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG2
10R-I128a	Fitzgerald	1 mg	EUR 489
Description: Mouse anti Human IgG2 antibody

Mouse anti Human IgG4
10R-I129a	Fitzgerald	1 mg	EUR 478
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgM
10R-I130a	Fitzgerald	1 mg	EUR 319
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10R-I130B	Fitzgerald	1 mg	EUR 300
Description: Mouse anti Human IgM antibody

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *
V100125	AAT Bioquest	50 ug	EUR 306
R-phrase: H-Phrase: Symbol for dangerous compounds: UNSPEC Code:

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *
V100126	AAT Bioquest	1 mg	EUR 393
R-phrase: H-Phrase: Symbol for dangerous compounds: UNSPEC Code:

Monoclonal Mouse Anti-Human IgA
C010208-10mg	Unibiotest	10mg	EUR 1114

Monoclonal Mouse Anti-Human IgA
C010208-1mg	Unibiotest	1mg	EUR 269

Monoclonal Mouse Anti-Human IgG4
C010211-10mg	Unibiotest	10mg	EUR 2213

Monoclonal Mouse Anti-Human IgG4
C010211-1mg	Unibiotest	1mg	EUR 438

Monoclonal Mouse Anti-Human IgG3
C010212-10mg	Unibiotest	10mg	EUR 2213

Monoclonal Mouse Anti-Human IgG3
C010212-1mg	Unibiotest	1mg	EUR 438

Monoclonal Mouse Anti-Human IgG2
C010214-10mg	Unibiotest	10mg	EUR 2213

Monoclonal Mouse Anti-Human IgG2
C010214-1mg	Unibiotest	1mg	EUR 438

Monoclonal Mouse Anti-Human IgG1
C010215-10mg	Unibiotest	10mg	EUR 2213

Monoclonal Mouse Anti-Human IgG1
C010215-1mg	Unibiotest	1mg	EUR 438

Mouse Anti Human IgG McAb
E61I00301	EnoGene	100ug	EUR 343

Mouse Anti Human IgG-Biotin
E61I00302	EnoGene	1mg	EUR 499

Mouse Anti Human IgG-HRP
E61I00303	EnoGene	1mg	EUR 499

Mouse Anti Human IgG-FITC
E61I00304	EnoGene	1mg	EUR 611

Mouse Anti-Human IgA Antibody
abx120109-1mg	Abbexa	1 mg	EUR 551
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx120110-1mg	Abbexa	1 mg	EUR 599
Shipped within 5-10 working days.

Mouse Anti-Human IgA Antibody
20-abx134799	Abbexa	EUR 286.00 EUR 439.00	100 ul 500 ul
Shipped within 5-10 working days.

Mouse Anti-Human IgM Antibody
20-abx134803	Abbexa	EUR 258.00 EUR 342.00	100 ul 500 ul
Shipped within 5-10 working days.

Mouse Anti-Human IgA1 Antibody
abx023353-1mg	Abbexa	1 mg	EUR 523
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023354-1mg	Abbexa	1 mg	EUR 662
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023355-1mg	Abbexa	1 mg	EUR 481
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023356-1mg	Abbexa	1 mg	EUR 467
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023357-1mg	Abbexa	1 mg	EUR 481
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023358-1mg	Abbexa	1 mg	EUR 481
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023359-1mg	Abbexa	1 mg	EUR 481
Shipped within 5-10 working days.

Mouse Anti-Human IgM Antibody
abx023365-1mg	Abbexa	1 mg	EUR 662
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023373-05mg	Abbexa	0.5 mg	EUR 1205
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023376-1mg	Abbexa	1 mg	EUR 599
Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody
abx023378-1mg	Abbexa	1 mg	EUR 599
Shipped within 5-10 working days.

Mouse Anti-Human IgG Antibody
abx023381-1mg	Abbexa	1 mg	EUR 439
Shipped within 5-10 working days.

Mouse Anti-Human IgM Antibody
abx023388-1mg	Abbexa	1 mg	EUR 599
Shipped within 5-10 working days.

Mouse anti-Human IgG Antibody
abx015704-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Mouse anti-Human IgG4 Antibody
abx401328-02mg	Abbexa	0.2 mg	EUR 565
Shipped within 1 week.

Mouse anti-Human IgG2 Antibody
abx401379-02mg	Abbexa	0.2 mg	EUR 565
Shipped within 1 week.

Mouse anti-Human IgA2 Antibody
abx401099-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Mouse anti-Human IgG1 Antibody
abx401124-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Mouse anti-Human IgG2 Antibody
abx401126-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Mouse anti-Human IgG3 Antibody
abx401127-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Mouse anti-Human IgD Antibody
abx401157-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Mouse anti-Human IgG4 Antibody
abx401164-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Mouse anti Human IgE (HRP)
43R-1585	Fitzgerald	100 ug	EUR 282
Description: Mouse anti Human IgE antibody (HRP)

Mouse anti Human IgM (HRP)
43R-1586	Fitzgerald	100 ug	EUR 282
Description: Mouse anti Human IgM antibody (HRP)

Mouse anti Human IgA (HRP)
43R-1587	Fitzgerald	100 ug	EUR 282
Description: Mouse anti Human IgA antibody (HRP)

Mouse anti Human IgG4 (HRP)
43R-1655	Fitzgerald	1 ml	EUR 262
Description: Mouse anti Human IgG4 pFC antibody

Mouse anti Human IgG1 (HRP)
43-1003	Fitzgerald	1 ml	EUR 314
Description: Mouse Anti-Human IgG1, Fc-HRP

Mouse anti Human IgG (HRP)
40R-1008	Fitzgerald	100 ug	EUR 282
Description: Mouse anti Human IgG antibody (HRP)

Mouse anti Human IgG Kappa
40R-1013	Fitzgerald	500 ug	EUR 565
Description: Mouse anti Human IgG Kappa Light Chain secondary antibody

Mouse anti Human IgG Lambda
40R-1014	Fitzgerald	500 ug	EUR 532
Description: Mouse anti Human IgG Lambda Light Chain secondary antibody

Mouse anti Human IgG Fc
10-7811	Fitzgerald	1 mg	EUR 336
Description: Mouse anti Human IgG Fc antibody

Mouse anti Human IgG4 antibody
10-I129A	Fitzgerald	1 mg	EUR 329
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgG (Fc)
10-I17B	Fitzgerald	500 ug	EUR 250
Description: Mouse anti Human IgG antibody (Fc)

Mouse anti Human IgG2 (Fab)
10-I26A	Fitzgerald	200 ug	EUR 392
Description: Mouse anti Human IgG2 antibody (Fab)

Mouse anti Human IgG antibody
10R-1960	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal human IgG antibody

Mouse anti Human IgM antibody
10R-1975	Fitzgerald	100 ul	EUR 241
Description: Mouse anti Human IgM antibody

Mouse anti-human IGJ