Mouse anti-human IGJ

Mouse anti-human IGJ 

To Order Contact us:

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Mouse IGJ shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IGJ Recombinant Protein (Mouse)

RP143243 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGJ antibody

10R-6990 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody

10R-6992 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody

10R-6994 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody

10R-6995 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody

10R-4454 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody

10R-4455 100 ul
EUR 726
Description: Mouse monoclonal IGJ antibody

IGJ antibody

10R-4456 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody


ELA-E0643h 96 Tests
EUR 824


EF000679 96 Tests
EUR 689

Human IGJ shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IGJ Recombinant Protein (Human)

RP015793 100 ug Ask for price

Mouse Immunoglobulin J chain (Igj)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 17.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Immunoglobulin J chain(Igj) expressed in Yeast

Igj ORF Vector (Mouse) (pORF)

ORF047749 1.0 ug DNA
EUR 506

Rabbit Anti-Human IGJ Polyclonal Antibody(Pre-diluted)

CPBT-36213RH 7ml
EUR 991

IGJ cloning plasmid

CSB-CL011337HU-10ug 10ug
EUR 244
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 480
  • Sequence: atgaagaaccatttgcttttctggggagtcctggcggtttttattaaggctgttcatgtgaaagcccaagaagatgaaaggattgttcttgttgacaacaaatgtaagtgtgcccggattacttccaggatcatccgttcttccgaagatcctaatgaggacattgtggagagaaa
  • Show more
Description: A cloning plasmid for the IGJ gene.

IGJ ORF Vector (Human) (pORF)

ORF005265 1.0 ug DNA
EUR 95

Igj sgRNA CRISPR Lentivector set (Mouse)

K3363801 3 x 1.0 ug
EUR 339

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

IGJ protein (His tag)

80R-2743 100 ug
EUR 322
Description: Purified recombinant IGJ protein (His tag)

Human Immunoglobulin J Chain (IGJ) Antibody

30165-05111 150 ug
EUR 261

IGJ sgRNA CRISPR Lentivector set (Human)

K1049501 3 x 1.0 ug
EUR 339

IGJ Immunoglobulin J Human Recombinant Protein

PROTP01591 Regular: 20ug
EUR 317
Description: IGJ Human Recombinant produced in E. coli is a single polypeptide chain containing 160 amino acids (23-159) and having a molecular mass of 18kDa. IGJ is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Immunoglobulin J chain, Igj ELISA KIT

ELI-02274m 96 Tests
EUR 865

Igj sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3363802 1.0 ug DNA
EUR 154

Igj sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3363803 1.0 ug DNA
EUR 154

Igj sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3363804 1.0 ug DNA
EUR 154

IGJ Protein Vector (Mouse) (pPB-C-His)

PV190994 500 ng
EUR 603

IGJ Protein Vector (Mouse) (pPB-N-His)

PV190995 500 ng
EUR 603

IGJ Protein Vector (Mouse) (pPM-C-HA)

PV190996 500 ng
EUR 603

IGJ Protein Vector (Mouse) (pPM-C-His)

PV190997 500 ng
EUR 603

Immunoglobulin J Chain (IGJ) Antibody

abx234187-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human IGJ(Immunoglobulin J chain) ELISA Kit

EH0989 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: P01591
  • Alias: IGJ/Immunoglobulin J chain/IGCJ
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Immunoglobulin J chain, IGJ ELISA KIT

ELI-02275h 96 Tests
EUR 824

IGJ sgRNA CRISPR Lentivector (Human) (Target 1)

K1049502 1.0 ug DNA
EUR 154

IGJ sgRNA CRISPR Lentivector (Human) (Target 2)

K1049503 1.0 ug DNA
EUR 154

IGJ sgRNA CRISPR Lentivector (Human) (Target 3)

K1049504 1.0 ug DNA
EUR 154

Human Immunoglobulin J chain(IGJ) ELISA kit

CSB-E09237h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Immunoglobulin J chain (IGJ) in samples from serum, plasma, saliva, urine, tear, breastmilk. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Immunoglobulin J chain(IGJ) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Immunoglobulin J chain(IGJ) in samples from serum, plasma, saliva, urine, tear, breastmilk. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Recombinant Human IGJ Protein, His, E.coli-1mg

QP12387-1mg 1mg
EUR 2757

Recombinant Human IGJ Protein, His, E.coli-20ug

QP12387-20ug 20ug
EUR 201

Recombinant Human IGJ Protein, His, E.coli-5ug

QP12387-5ug 5ug
EUR 155

IGJ Protein Vector (Human) (pPB-C-His)

PV021057 500 ng
EUR 329

IGJ Protein Vector (Human) (pPB-N-His)

PV021058 500 ng
EUR 329

IGJ Protein Vector (Human) (pPM-C-HA)

PV021059 500 ng
EUR 329

IGJ Protein Vector (Human) (pPM-C-His)

PV021060 500 ng
EUR 329

Mouse Immunoglobulin J chain / IGJ (JCHAIN) ELISA Kit

abx513597-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Immunoglobulin J Chain (IGJ) AssayMax ELISA Kit

EI1701-1 96 Well Plate
EUR 417

Human Immunoglobulin J chain / IGJ (JCHAIN) ELISA Kit

abx253943-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Immunoglobulin J Chain (IGJ) Antibody (Biotin Conjugate)

30165-05121 150 ug
EUR 369

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC Conjugate)

30165-05141 150 ug
EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (RPE Conjugate)

30165-05151 150 ug
EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (APC Conjugate)

30165-05161 150 ug
EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (PerCP Conjugate)

30165-05171 150 ug
EUR 471

Rabbit Immunoglobulin J chain, IGJ ELISA KIT

ELI-02276Ra 96 Tests
EUR 928

Igj 3'UTR GFP Stable Cell Line

TU159977 1.0 ml Ask for price

IGJ 3'UTR Luciferase Stable Cell Line

TU010769 1.0 ml
EUR 1394

Igj 3'UTR Luciferase Stable Cell Line

TU109977 1.0 ml Ask for price

IGJ 3'UTR GFP Stable Cell Line

TU060769 1.0 ml
EUR 1394

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3363805 3 x 1.0 ug
EUR 376

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1049505 3 x 1.0 ug
EUR 376

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3363806 1.0 ug DNA
EUR 167

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3363807 1.0 ug DNA
EUR 167

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3363808 1.0 ug DNA
EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1049506 1.0 ug DNA
EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1049507 1.0 ug DNA
EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1049508 1.0 ug DNA
EUR 167

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)

30165-05181 1 x 75 ug, 3 x 30 ug
EUR 585

Human Immunoglobulin J Chain (IGJ) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit

FACS30165M Kit
EUR 693

Mouse Anti Human IgM

E61I00402 100ug
EUR 343

Mouse anti human IgA

E61I02101 100ug
EUR 343

Mouse anti human IgE

E61I02201 100ug
EUR 343

Mouse anti Human IgM

41R-1586 100 ug
EUR 265
Description: Monoclonal Mouse anti Human IgM antibody

Mouse anti Human IgE

40R-1000 100 ug
EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgA

40R-1001 100 ug
EUR 265
Description: Mouse anti Human IgA antibody

Mouse anti Human IgG

40R-1003 100 ug
EUR 265
Description: Mouse anti Human IgG antibody

Mouse anti Human IgE

40R-1004 100 ug
EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgM

40R-1005 100 ug
EUR 265
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA

40R-1006 100 ug
EUR 265
Description: Mouse anti Human IgA antibody

Mouse anti Human IgA

40R-1011 500 ug
EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgA

40R-1012 500 ug
EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgG3

40R-1015 1 mg
EUR 414
Description: Mouse anti Human IgG3 antibody

Mouse anti Human IgM

10C-CR2023M2 1 mg
EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM

10C-CR2023M3 1 mg
EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA

10C-CR6043M1 1 mg
EUR 241
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE

10C-CR6046M3 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10C-CR6046M4 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10C-CR6046M5 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG

10C-CR6047M1 1 mg
EUR 176
Description: Mouse anti Human IgG antibody

Mouse anti Human IgG

10C-CR6047M2 1 mg
EUR 176
Description: Mouse anti Human IgG antibody

Mouse anti Human IgA

10-7808 1 mg
EUR 336
Description: Mouse anti Human IgA antibody

Mouse anti Human IgA

10-I05A 1 mg
EUR 308
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE

10-I104B 1 mg
EUR 336
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10-I104CC 1 mg
EUR 336
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10-I10A 1 mg
EUR 181
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10-I10C 1 mg
EUR 181
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10-I10E 1 mg
EUR 495
Description: Mouse anti Human IgE antibody

Mouse anti Human IgM

10-I20A 1 mg
EUR 191
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM

10-I20B 1 mg
EUR 295
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM

10-I20G 1 mg
EUR 295
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM

10-I20H 1 mg
EUR 187
Description: Mouse anti Human IgM antibody

Mouse anti Human IgG1

10-I21A 200 ug
EUR 220
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG2

10-I22A 200 ug
EUR 392
Description: Mouse anti Human IgG2 antibody

Mouse anti Human IgG3

10-I23A 200 ug
EUR 635
Description: Mouse anti Human IgG3 antibody

Mouse anti Human IgG4

10-I24A 200 ug
EUR 392
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgE

10-S9601MND1-M0 1 mg
EUR 219
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10-1025 1 mg
EUR 327
Description: Mouse monoclonal Mouse anti Human IgE antibody

Mouse anti Human IgE

10-1026 1 mg
EUR 327
Description: Mouse monoclonal Mouse anti Human IgE antibody

Mouse anti Human IgE

10-1027 1 mg
EUR 327
Description: Mouse monoclonal Mouse anti Human IgE antibody

Mouse anti Human IgE

10R-I104d 1 mg
EUR 447
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10R-I104e 1 mg
EUR 489
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG1

10R-I110a 1 ml
EUR 554
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG1

10R-I127a 1 mg
EUR 489
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG2

10R-I128a 1 mg
EUR 489
Description: Mouse anti Human IgG2 antibody

Mouse anti Human IgG4

10R-I129a 1 mg
EUR 478
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgM

10R-I130a 1 mg
EUR 319
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM

10R-I130B 1 mg
EUR 300
Description: Mouse anti Human IgM antibody

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100125 50 ug
EUR 306
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100126 1 mg
EUR 393
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Monoclonal Mouse Anti-Human IgA

C010208-10mg 10mg
EUR 1114

Monoclonal Mouse Anti-Human IgA

C010208-1mg 1mg
EUR 269

Monoclonal Mouse Anti-Human IgG4

C010211-10mg 10mg
EUR 2213

Monoclonal Mouse Anti-Human IgG4

C010211-1mg 1mg
EUR 438

Monoclonal Mouse Anti-Human IgG3

C010212-10mg 10mg
EUR 2213

Monoclonal Mouse Anti-Human IgG3

C010212-1mg 1mg
EUR 438

Monoclonal Mouse Anti-Human IgG2

C010214-10mg 10mg
EUR 2213

Monoclonal Mouse Anti-Human IgG2

C010214-1mg 1mg
EUR 438

Monoclonal Mouse Anti-Human IgG1

C010215-10mg 10mg
EUR 2213

Monoclonal Mouse Anti-Human IgG1

C010215-1mg 1mg
EUR 438

Mouse Anti Human IgG McAb

E61I00301 100ug
EUR 343

Mouse Anti Human IgG-Biotin

E61I00302 1mg
EUR 499

Mouse Anti Human IgG-HRP

E61I00303 1mg
EUR 499

Mouse Anti Human IgG-FITC

E61I00304 1mg
EUR 611

Mouse Anti-Human IgA Antibody

abx120109-1mg 1 mg
EUR 551
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx120110-1mg 1 mg
EUR 599
  • Shipped within 5-10 working days.

Mouse Anti-Human IgA Antibody

  • EUR 286.00
  • EUR 439.00
  • 100 ul
  • 500 ul
  • Shipped within 5-10 working days.

Mouse Anti-Human IgM Antibody

  • EUR 258.00
  • EUR 342.00
  • 100 ul
  • 500 ul
  • Shipped within 5-10 working days.

Mouse Anti-Human IgA1 Antibody

abx023353-1mg 1 mg
EUR 523
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023354-1mg 1 mg
EUR 662
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023355-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023356-1mg 1 mg
EUR 467
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023357-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023358-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023359-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Mouse Anti-Human IgM Antibody

abx023365-1mg 1 mg
EUR 662
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023373-05mg 0.5 mg
EUR 1205
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023376-1mg 1 mg
EUR 599
  • Shipped within 5-10 working days.

Mouse Anti-Human IgE Antibody

abx023378-1mg 1 mg
EUR 599
  • Shipped within 5-10 working days.

Mouse Anti-Human IgG Antibody

abx023381-1mg 1 mg
EUR 439
  • Shipped within 5-10 working days.

Mouse Anti-Human IgM Antibody

abx023388-1mg 1 mg
EUR 599
  • Shipped within 5-10 working days.

Mouse anti-Human IgG Antibody

abx015704-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Mouse anti-Human IgG4 Antibody

abx401328-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Mouse anti-Human IgG2 Antibody

abx401379-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Mouse anti-Human IgA2 Antibody

abx401099-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Mouse anti-Human IgG1 Antibody

abx401124-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Mouse anti-Human IgG2 Antibody

abx401126-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Mouse anti-Human IgG3 Antibody

abx401127-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Mouse anti-Human IgD Antibody

abx401157-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Mouse anti-Human IgG4 Antibody

abx401164-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Mouse anti Human IgE (HRP)

43R-1585 100 ug
EUR 282
Description: Mouse anti Human IgE antibody (HRP)

Mouse anti Human IgM (HRP)

43R-1586 100 ug
EUR 282
Description: Mouse anti Human IgM antibody (HRP)

Mouse anti Human IgA (HRP)

43R-1587 100 ug
EUR 282
Description: Mouse anti Human IgA antibody (HRP)

Mouse anti Human IgG4 (HRP)

43R-1655 1 ml
EUR 262
Description: Mouse anti Human IgG4 pFC antibody

Mouse anti Human IgG1 (HRP)

43-1003 1 ml
EUR 314
Description: Mouse Anti-Human IgG1, Fc-HRP

Mouse anti Human IgG (HRP)

40R-1008 100 ug
EUR 282
Description: Mouse anti Human IgG antibody (HRP)

Mouse anti Human IgG Kappa

40R-1013 500 ug
EUR 565
Description: Mouse anti Human IgG Kappa Light Chain secondary antibody

Mouse anti Human IgG Lambda

40R-1014 500 ug
EUR 532
Description: Mouse anti Human IgG Lambda Light Chain secondary antibody

Mouse anti Human IgG Fc

10-7811 1 mg
EUR 336
Description: Mouse anti Human IgG Fc antibody

Mouse anti Human IgG4 antibody

10-I129A 1 mg
EUR 329
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgG (Fc)

10-I17B 500 ug
EUR 250
Description: Mouse anti Human IgG antibody (Fc)

Mouse anti Human IgG2 (Fab)

10-I26A 200 ug
EUR 392
Description: Mouse anti Human IgG2 antibody (Fab)

Mouse anti Human IgG antibody

10R-1960 100 ul
EUR 241
Description: Mouse monoclonal human IgG antibody

Mouse anti Human IgM antibody

10R-1975 100 ul
EUR 241
Description: Mouse anti Human IgM antibody

Mouse anti-human IGJ