Mouse anti-human IGJ

Mouse anti-human IGJ 

To Order Contact us: caitlyn@ucb-bioproducts.com

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349

Mouse IGJ shRNA Plasmid
20-abx970998
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IGJ Recombinant Protein (Mouse)
RP143243 100 ug Ask for price

IGJ antibody
10R-4454 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-4455 100 ul
EUR 726
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-4456 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6990 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6992 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6994 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ antibody
10R-6995 100 ul
EUR 691
Description: Mouse monoclonal IGJ antibody

IGJ siRNA
20-abx920335
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGJ siRNA
20-abx920336
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human IGJ ELISA Kit
ELA-E0643h 96 Tests
EUR 824

IGJ ELISA KIT|Human
EF000679 96 Tests
EUR 689

Human IGJ shRNA Plasmid
20-abx952364
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IGJ Recombinant Protein (Human)
RP015793 100 ug Ask for price

Mouse Immunoglobulin J chain (Igj)
1-CSB-YP011337MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 17.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Immunoglobulin J chain(Igj) expressed in Yeast

Igj ORF Vector (Mouse) (pORF)
ORF047749 1.0 ug DNA
EUR 506

Rabbit Anti-Human IGJ Polyclonal Antibody(Pre-diluted)
CPBT-36213RH 7ml
EUR 991

IGJ cloning plasmid
CSB-CL011337HU-10ug 10ug
EUR 244
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 480
  • Sequence: atgaagaaccatttgcttttctggggagtcctggcggtttttattaaggctgttcatgtgaaagcccaagaagatgaaaggattgttcttgttgacaacaaatgtaagtgtgcccggattacttccaggatcatccgttcttccgaagatcctaatgaggacattgtggagagaaa
  • Show more
Description: A cloning plasmid for the IGJ gene.

IGJ ORF Vector (Human) (pORF)
ORF005265 1.0 ug DNA
EUR 95

Igj sgRNA CRISPR Lentivector set (Mouse)
K3363801 3 x 1.0 ug
EUR 339

Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280

IGJ protein (His tag)
80R-2743 100 ug
EUR 322
Description: Purified recombinant IGJ protein (His tag)

Human Immunoglobulin J Chain (IGJ) Antibody
30165-05111 150 ug
EUR 261

IGJ sgRNA CRISPR Lentivector set (Human)
K1049501 3 x 1.0 ug
EUR 339

IGJ Immunoglobulin J Human Recombinant Protein
PROTP01591 Regular: 20ug
EUR 317
Description: IGJ Human Recombinant produced in E. coli is a single polypeptide chain containing 160 amino acids (23-159) and having a molecular mass of 18kDa. IGJ is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Immunoglobulin J chain, Igj ELISA KIT
ELI-02274m 96 Tests
EUR 865

Igj sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3363802 1.0 ug DNA
EUR 154

Igj sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3363803 1.0 ug DNA
EUR 154

Igj sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3363804 1.0 ug DNA
EUR 154

IGJ Protein Vector (Mouse) (pPB-C-His)
PV190994 500 ng
EUR 603

IGJ Protein Vector (Mouse) (pPB-N-His)
PV190995 500 ng
EUR 603

IGJ Protein Vector (Mouse) (pPM-C-HA)
PV190996 500 ng
EUR 603

IGJ Protein Vector (Mouse) (pPM-C-His)
PV190997 500 ng
EUR 603

Immunoglobulin J Chain (IGJ) Antibody
abx234187-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human IGJ(Immunoglobulin J chain) ELISA Kit
EH0989 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: P01591
  • Alias: IGJ/Immunoglobulin J chain/IGCJ
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Immunoglobulin J chain, IGJ ELISA KIT
ELI-02275h 96 Tests
EUR 824

Human Immunoglobulin J chain(IGJ) ELISA kit
CSB-E09237h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Immunoglobulin J chain (IGJ) in samples from serum, plasma, saliva, urine, tear, breastmilk. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Immunoglobulin J chain(IGJ) ELISA kit
1-CSB-E09237h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Immunoglobulin J chain(IGJ) in samples from serum, plasma, saliva, urine, tear, breastmilk. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

IGJ sgRNA CRISPR Lentivector (Human) (Target 1)
K1049502 1.0 ug DNA
EUR 154

IGJ sgRNA CRISPR Lentivector (Human) (Target 2)
K1049503 1.0 ug DNA
EUR 154

IGJ sgRNA CRISPR Lentivector (Human) (Target 3)
K1049504 1.0 ug DNA
EUR 154

IGJ Protein Vector (Human) (pPB-C-His)
PV021057 500 ng
EUR 329

IGJ Protein Vector (Human) (pPB-N-His)
PV021058 500 ng
EUR 329

IGJ Protein Vector (Human) (pPM-C-HA)
PV021059 500 ng
EUR 329

IGJ Protein Vector (Human) (pPM-C-His)
PV021060 500 ng
EUR 329

Recombinant Human IGJ Protein, His, E.coli-1mg
QP12387-1mg 1mg
EUR 2757

Recombinant Human IGJ Protein, His, E.coli-20ug
QP12387-20ug 20ug
EUR 201

Recombinant Human IGJ Protein, His, E.coli-5ug
QP12387-5ug 5ug
EUR 155

Mouse Immunoglobulin J chain / IGJ (JCHAIN) ELISA Kit
abx513597-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Immunoglobulin J Chain (IGJ) Antibody (Biotin Conjugate)
30165-05121 150 ug
EUR 369

Human Immunoglobulin J chain / IGJ (JCHAIN) ELISA Kit
abx253943-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Immunoglobulin J Chain (IGJ) AssayMax ELISA Kit
EI1701-1 96 Well Plate
EUR 417

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC Conjugate)
30165-05141 150 ug
EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (RPE Conjugate)
30165-05151 150 ug
EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (APC Conjugate)
30165-05161 150 ug
EUR 428

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (PerCP Conjugate)
30165-05171 150 ug
EUR 471

Rabbit Immunoglobulin J chain, IGJ ELISA KIT
ELI-02276Ra 96 Tests
EUR 928

Igj 3'UTR Luciferase Stable Cell Line
TU109977 1.0 ml Ask for price

Igj 3'UTR GFP Stable Cell Line
TU159977 1.0 ml Ask for price

IGJ 3'UTR GFP Stable Cell Line
TU060769 1.0 ml
EUR 1394

IGJ 3'UTR Luciferase Stable Cell Line
TU010769 1.0 ml
EUR 1394

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3363805 3 x 1.0 ug
EUR 376

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1049505 3 x 1.0 ug
EUR 376

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3363806 1.0 ug DNA
EUR 167

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3363807 1.0 ug DNA
EUR 167

Igj sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3363808 1.0 ug DNA
EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1049506 1.0 ug DNA
EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1049507 1.0 ug DNA
EUR 167

IGJ sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1049508 1.0 ug DNA
EUR 167

Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)
30165-05181 1 x 75 ug, 3 x 30 ug
EUR 585

Human Immunoglobulin J Chain (IGJ) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit
FACS30165M Kit
EUR 693

Mouse anti Human IgE
10R-I104d 1 mg
EUR 447
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10R-I104e 1 mg
EUR 489
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG1
10R-I110a 1 ml
EUR 554
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG1
10R-I127a 1 mg
EUR 489
Description: Mouse anti Human IgG1 antibody

Mouse anti Human IgG2
10R-I128a 1 mg
EUR 489
Description: Mouse anti Human IgG2 antibody

Mouse anti Human IgG4
10R-I129a 1 mg
EUR 478
Description: Mouse anti Human IgG4 antibody

Mouse anti Human IgM
10R-I130a 1 mg
EUR 319
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10R-I130B 1 mg
EUR 300
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10C-CR2023M2 1 mg
EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10C-CR2023M3 1 mg
EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA
10C-CR6043M1 1 mg
EUR 241
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE
10C-CR6046M3 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10C-CR6046M4 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10C-CR6046M5 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG
10C-CR6047M1 1 mg
EUR 176
Description: Mouse anti Human IgG antibody

Mouse anti Human IgG
10C-CR6047M2 1 mg
EUR 176
Description: Mouse anti Human IgG antibody

Mouse anti Human IgA
10-7808 1 mg
EUR 336
Description: Mouse anti Human IgA antibody

Mouse anti Human IgA
10-I05A 1 mg
EUR 308
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE
10-I104B 1 mg
EUR 336
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10-I104CC 1 mg
EUR 336
Description: Mouse anti Human IgE antibody

Mouse anti-human IGJ

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Blog Theme