MAP4K5 Antibody (pSer174)

MAP4K5 Antibody (pSer174) 

To Order Contact us:

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A565 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 565.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A594 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 594.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A633 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 633.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A655 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 655.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A680 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 680.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A700 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 700.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-ALP 0.1ml
EUR 394
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-APC 0.1ml
EUR 399
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to APC .

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-APCCY7 0.1ml
EUR 471
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to APC/Cy7.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-BI 0.1ml
EUR 396
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Biotin.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY350 0.1ml
EUR 475
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 350.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY405 0.1ml
EUR 452
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 405.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY488 0.1ml
EUR 432
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 488.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY594 0.1ml
EUR 436
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 594.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY633 0.1ml
EUR 426
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 633.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-FITC 0.1ml
EUR 392
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to FITC.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-HRP 0.1ml
EUR 388
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to HRP.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-P594 0.1ml
EUR 407
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to PE/ATTO 594.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-PCP 0.1ml
EUR 399
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to PerCP.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-RPE 0.1ml
EUR 397
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to RPE .

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-STR 0.1ml
EUR 398
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Streptavidin.

MAP4K5 antibody

70R-18397 50 ul
EUR 435
Description: Rabbit polyclonal MAP4K5 antibody

MAP4K5 Antibody

35950-100ul 100ul
EUR 252

MAP4K5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4K5 Antibody

DF2337 200ul
EUR 304
Description: MAP4K5 antibody detects endogenous levels of total MAP4K5.

MAP4K5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4K5 antibody

70R-5780 50 ug
EUR 467
Description: Rabbit polyclonal MAP4K5 antibody raised against the middle region of MAP4K5

MAP4K5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MAP4K5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MAP4K5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MAP4K5 Antibody

ABD2337 100 ug
EUR 438

MAP4K5 Conjugated Antibody

C35950 100ul
EUR 397

anti- MAP4K5 antibody

FNab04984 100µg
EUR 548.75
  • Immunogen: mitogen-activated protein kinase kinase kinase kinase 5
  • Uniprot ID: Q9Y4K4
  • Gene ID: 11183
  • Research Area: Metabolism
Description: Antibody raised against MAP4K5

Anti-MAP4K5 antibody

PAab04984 100 ug
EUR 386

Anti-MAP4K5 antibody

STJ110269 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene.

Anti-MAP4K5 antibody

STJ117333 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25759 50 ul
EUR 334
Description: Mouse polyclonal to MAP4K5

MAP4K5 Blocking Peptide

33R-7562 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAP4K5 antibody, catalog no. 70R-5780

MAP4K5 Blocking Peptide

DF2337-BP 1mg
EUR 195

MAP4K5 cloning plasmid

CSB-CL013440HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2541
  • Sequence: atggaggccccgctgcggcctgccgcggacatcctgaggcggaacccgcagcaggactacgaactcgtccagagggtcggcagcggcacctacggggacgtctataaggccagaaatgtacacacaggagagctggctgcagtaaaaatcattaaattggagcctggagatgatt
  • Show more
Description: A cloning plasmid for the MAP4K5 gene.

MAP4K5 Rabbit pAb

A7962-100ul 100 ul
EUR 308

MAP4K5 Rabbit pAb

A7962-200ul 200 ul
EUR 459

MAP4K5 Rabbit pAb

A7962-20ul 20 ul
EUR 183

MAP4K5 Rabbit pAb

A7962-50ul 50 ul
EUR 223

MAP4K5 Rabbit pAb

A15139-100ul 100 ul
EUR 308

MAP4K5 Rabbit pAb

A15139-200ul 200 ul
EUR 459

MAP4K5 Rabbit pAb

A15139-20ul 20 ul
EUR 183

MAP4K5 Rabbit pAb

A15139-50ul 50 ul
EUR 223

anti-MAP4K5 (3H3)

LF-MA10184 100 ug
EUR 363
Description: Mouse monoclonal to MAP4K5

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

abx145486-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

abx234984-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Map4k5 ELISA KIT

ELI-23813m 96 Tests
EUR 865


ELI-27850h 96 Tests
EUR 824


EF010823 96 Tests
EUR 689

Human MAP4K5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MAP4K5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Map4k5 ORF Vector (Rat) (pORF)

ORF070258 1.0 ug DNA
EUR 506

MAP4K5 ORF Vector (Human) (pORF)

ORF006257 1.0 ug DNA
EUR 95

Map4k5 ORF Vector (Mouse) (pORF)

ORF049760 1.0 ug DNA
EUR 506

Map4k5 sgRNA CRISPR Lentivector set (Rat)

K6236001 3 x 1.0 ug
EUR 339

MAP4K5 sgRNA CRISPR Lentivector set (Human)

K1265201 3 x 1.0 ug
EUR 339

Map4k5 sgRNA CRISPR Lentivector set (Mouse)

K4702601 3 x 1.0 ug
EUR 339

Map4k5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6236002 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6236003 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6236004 1.0 ug DNA
EUR 154

MAP4K5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1265202 1.0 ug DNA
EUR 154

MAP4K5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1265203 1.0 ug DNA
EUR 154

MAP4K5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1265204 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4702602 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4702603 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4702604 1.0 ug DNA
EUR 154

MAP4K5 Protein Vector (Human) (pPB-C-His)

PV025025 500 ng
EUR 329

MAP4K5 Protein Vector (Human) (pPB-N-His)

PV025026 500 ng
EUR 329

MAP4K5 Protein Vector (Human) (pPM-C-HA)

PV025027 500 ng
EUR 329

MAP4K5 Protein Vector (Human) (pPM-C-His)

PV025028 500 ng
EUR 329

MAP4K5 Protein Vector (Rat) (pPB-C-His)

PV281030 500 ng
EUR 1166

MAP4K5 Protein Vector (Rat) (pPB-N-His)

PV281031 500 ng
EUR 1166

MAP4K5 Protein Vector (Rat) (pPM-C-HA)

PV281032 500 ng
EUR 1166

MAP4K5 Protein Vector (Rat) (pPM-C-His)

PV281033 500 ng
EUR 1166

MAP4K5 Protein Vector (Mouse) (pPB-C-His)

PV199038 500 ng
EUR 1065

MAP4K5 Protein Vector (Mouse) (pPB-N-His)

PV199039 500 ng
EUR 1065

MAP4K5 Protein Vector (Mouse) (pPM-C-HA)

PV199040 500 ng
EUR 1065

MAP4K5 Protein Vector (Mouse) (pPM-C-His)

PV199041 500 ng
EUR 1065

Map4k5 3'UTR Luciferase Stable Cell Line

TU112878 1.0 ml Ask for price

Map4k5 3'UTR GFP Stable Cell Line

TU162878 1.0 ml Ask for price

Map4k5 3'UTR Luciferase Stable Cell Line

TU212841 1.0 ml Ask for price

Map4k5 3'UTR GFP Stable Cell Line

TU262841 1.0 ml Ask for price

MAP4K5 3'UTR GFP Stable Cell Line

TU062968 1.0 ml
EUR 1394

MAP4K5 3'UTR Luciferase Stable Cell Line

TU012968 1.0 ml
EUR 1394

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human MEK Kinase Kinase 5 (MAP4K5) ELISA Kit

abx388413-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6236005 3 x 1.0 ug
EUR 376

MAP4K5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1265205 3 x 1.0 ug
EUR 376

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4702605 3 x 1.0 ug
EUR 376

Recombinant Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y4K4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 expressed in: E.coli

Recombinant Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8BPM2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 expressed in: E.coli

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with APC.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with Biotin.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with Cy3.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with FITC.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with HRP.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with PE.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with APC.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with Biotin.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with Cy3.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with FITC.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with HRP.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with PE.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Thr613~His842)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with APC-Cy7.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4K5 (Ala9~Ser231)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5). This antibody is labeled with APC-Cy7.

Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6236006 1.0 ug DNA
EUR 167

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6236007 1.0 ug DNA
EUR 167

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6236008 1.0 ug DNA
EUR 167

MAP4K5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1265206 1.0 ug DNA
EUR 167

MAP4K5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1265207 1.0 ug DNA
EUR 167

MAP4K5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1265208 1.0 ug DNA
EUR 167

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4702606 1.0 ug DNA
EUR 167

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4702607 1.0 ug DNA
EUR 167

Map4k5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4702608 1.0 ug DNA
EUR 167

Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)ELISA Kit

201-12-2494 96 tests
EUR 440
  • This Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mitogen Activated Protein Kinase Kinase Kinase Kinase 5(MAP4K5)ELISA Kit

QY-E01401 96T
EUR 361

Rat Mitogen Activated Protein Kinase Kinase Kinase Kinase 5(MAP4K5)ELISA Kit

QY-E10577 96T
EUR 400

Mouse Mitogen Activated Protein Kinase Kinase Kinase Kinase 5(MAP4K5)ELISA Kit

QY-E21017 96T
EUR 361

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

MAP4K5 Antibody (pSer174)