MAP4K5 Antibody (pSer174)

MAP4K5 Antibody (pSer174) 

To Order Contact us:

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A565 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 565.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A594 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 594.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A633 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 633.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A655 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 655.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A680 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 680.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-A700 0.1ml
EUR 400
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to ATTO 700.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-ALP 0.1ml
EUR 394
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-APC 0.1ml
EUR 399
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to APC .

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-APCCY7 0.1ml
EUR 471
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to APC/Cy7.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-BI 0.1ml
EUR 396
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Biotin.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY350 0.1ml
EUR 475
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 350.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY405 0.1ml
EUR 452
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 405.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY488 0.1ml
EUR 432
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 488.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY594 0.1ml
EUR 436
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 594.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-DY633 0.1ml
EUR 426
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Dylight 633.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-FITC 0.1ml
EUR 392
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to FITC.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-HRP 0.1ml
EUR 388
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to HRP.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-P594 0.1ml
EUR 407
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to PE/ATTO 594.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-PCP 0.1ml
EUR 399
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to PerCP.

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-RPE 0.1ml
EUR 397
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to RPE .

Antibody for Human MAP4K5 (pSer174)

SPC-1002D-STR 0.1ml
EUR 398
  • May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway.
Description: A polyclonal antibody for MAP4K5 (pSer174) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser174 of human KHS1 (AA171-177). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This MAP4K5 (pSer174) antibody is conjugated to Streptavidin.

MAP4K5 antibody

70R-18397 50 ul
EUR 435
Description: Rabbit polyclonal MAP4K5 antibody

MAP4K5 Antibody

35950-100ul 100ul
EUR 252

MAP4K5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4K5 Antibody

DF2337 200ul
EUR 304
Description: MAP4K5 antibody detects endogenous levels of total MAP4K5.

MAP4K5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4K5 antibody

70R-5780 50 ug
EUR 467
Description: Rabbit polyclonal MAP4K5 antibody raised against the middle region of MAP4K5

MAP4K5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MAP4K5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MAP4K5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4K5. Recognizes MAP4K5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MAP4K5 Antibody

ABD2337 100 ug
EUR 438

MAP4K5 Conjugated Antibody

C35950 100ul
EUR 397

anti- MAP4K5 antibody

FNab04984 100µg
EUR 548.75
  • Immunogen: mitogen-activated protein kinase kinase kinase kinase 5
  • Uniprot ID: Q9Y4K4
  • Gene ID: 11183
  • Research Area: Metabolism
Description: Antibody raised against MAP4K5

Anti-MAP4K5 antibody

PAab04984 100 ug
EUR 386

Anti-MAP4K5 antibody

STJ110269 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene.

Anti-MAP4K5 antibody

STJ117333 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25759 50 ul
EUR 334
Description: Mouse polyclonal to MAP4K5

MAP4K5 Blocking Peptide

33R-7562 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAP4K5 antibody, catalog no. 70R-5780

MAP4K5 Blocking Peptide

DF2337-BP 1mg
EUR 195

MAP4K5 cloning plasmid

CSB-CL013440HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2541
  • Sequence: atggaggccccgctgcggcctgccgcggacatcctgaggcggaacccgcagcaggactacgaactcgtccagagggtcggcagcggcacctacggggacgtctataaggccagaaatgtacacacaggagagctggctgcagtaaaaatcattaaattggagcctggagatgatt
  • Show more
Description: A cloning plasmid for the MAP4K5 gene.

MAP4K5 Rabbit pAb

A7962-100ul 100 ul
EUR 308

MAP4K5 Rabbit pAb

A7962-200ul 200 ul
EUR 459

MAP4K5 Rabbit pAb

A7962-20ul 20 ul
EUR 183

MAP4K5 Rabbit pAb

A7962-50ul 50 ul
EUR 223

MAP4K5 Rabbit pAb

A15139-100ul 100 ul
EUR 308

MAP4K5 Rabbit pAb

A15139-200ul 200 ul
EUR 459

MAP4K5 Rabbit pAb

A15139-20ul 20 ul
EUR 183

MAP4K5 Rabbit pAb

A15139-50ul 50 ul
EUR 223

anti-MAP4K5 (3H3)

LF-MA10184 100 ug
EUR 363
Description: Mouse monoclonal to MAP4K5

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

abx145486-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

abx234984-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MEK Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Map4k5 ELISA KIT

ELI-23813m 96 Tests
EUR 865


ELI-27850h 96 Tests
EUR 824


EF010823 96 Tests
EUR 689

Human MAP4K5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MAP4K5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Map4k5 ORF Vector (Rat) (pORF)

ORF070258 1.0 ug DNA
EUR 506

MAP4K5 ORF Vector (Human) (pORF)

ORF006257 1.0 ug DNA
EUR 95

Map4k5 ORF Vector (Mouse) (pORF)

ORF049760 1.0 ug DNA
EUR 506

Map4k5 sgRNA CRISPR Lentivector set (Rat)

K6236001 3 x 1.0 ug
EUR 339

MAP4K5 sgRNA CRISPR Lentivector set (Human)

K1265201 3 x 1.0 ug
EUR 339

Map4k5 sgRNA CRISPR Lentivector set (Mouse)

K4702601 3 x 1.0 ug
EUR 339

Map4k5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6236002 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6236003 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6236004 1.0 ug DNA
EUR 154

MAP4K5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1265202 1.0 ug DNA
EUR 154

MAP4K5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1265203 1.0 ug DNA
EUR 154

MAP4K5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1265204 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4702602 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4702603 1.0 ug DNA
EUR 154

Map4k5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4702604 1.0 ug DNA
EUR 154

MAP4K5 Protein Vector (Human) (pPB-C-His)

PV025025 500 ng
EUR 329

MAP4K5 Protein Vector (Human) (pPB-N-His)

PV025026 500 ng
EUR 329

MAP4K5 Protein Vector (Human) (pPM-C-HA)

PV025027 500 ng
EUR 329

MAP4K5 Protein Vector (Human) (pPM-C-His)

PV025028 500 ng
EUR 329

MAP4K5 Protein Vector (Rat) (pPB-C-His)

PV281030 500 ng
EUR 1166

MAP4K5 Protein Vector (Rat) (pPB-N-His)

PV281031 500 ng
EUR 1166

MAP4K5 Protein Vector (Rat) (pPM-C-HA)

PV281032 500 ng
EUR 1166

MAP4K5 Protein Vector (Rat) (pPM-C-His)

PV281033 500 ng
EUR 1166

MAP4K5 Protein Vector (Mouse) (pPB-C-His)

PV199038 500 ng
EUR 1065

MAP4K5 Protein Vector (Mouse) (pPB-N-His)

PV199039 500 ng
EUR 1065

MAP4K5 Protein Vector (Mouse) (pPM-C-HA)

PV199040 500 ng
EUR 1065

MAP4K5 Protein Vector (Mouse) (pPM-C-His)

PV199041 500 ng
EUR 1065

Map4k5 3'UTR Luciferase Stable Cell Line

TU112878 1.0 ml Ask for price

Map4k5 3'UTR GFP Stable Cell Line

TU162878 1.0 ml Ask for price

Map4k5 3'UTR Luciferase Stable Cell Line

TU212841 1.0 ml Ask for price

Map4k5 3'UTR GFP Stable Cell Line

TU262841 1.0 ml Ask for price

MAP4K5 3'UTR GFP Stable Cell Line

TU062968 1.0 ml
EUR 1394

MAP4K5 3'UTR Luciferase Stable Cell Line

TU012968 1.0 ml
EUR 1394

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MAP4K5 Antibody (pSer174)