LKB1 AAK1 dual inhibitor

LKB1 AAK1 dual inhibitor 

To Order Contact us: caitlyn@ucb-bioproducts.com

LKB1 (AAK1 dual inhibitor)

A3556-50 50 mg
EUR 975
Description: LKB1 is a selective inhibitor of Pim-1 kinase with Kd value of 35 nM [1].Pim-1 (proto-oncogene serine/threonine-protein kinase) is a proto-oncogene encodes by PIM1 gene and is reported to play an important role in multiple human cancers.

LKB1 (LKB1) Antibody

20-abx141003
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

LKB1 (LKB1) Antibody

abx234802-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Aak1/ Rat Aak1 ELISA Kit

ELI-12232r 96 Tests
EUR 886

Aak1 Antibody

24767-100ul 100ul
EUR 390

Aak1 Antibody

24772-100ul 100ul
EUR 390

AAK1 antibody

20R-1733 100 ug
EUR 673
Description: Rabbit polyclonal AAK1 antibody

AAK1 antibody

70R-12106 100 ug
EUR 403
Description: Rabbit polyclonal AAK1 antibody

AAK1 antibody

70R-31935 100 ug
EUR 327
Description: Rabbit polyclonal AAK1 antibody

AAK1 Antibody

33919-100ul 100ul
EUR 252

AAK1 Antibody

33919-50ul 50ul
EUR 187

AAK1 Antibody

3810-100
EUR 316

AAK1 Antibody

3810-30T
EUR 146

AAK1 Antibody

1-CSB-PA000776
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AAK1. Recognizes AAK1 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

AAK1 Antibody

1-CSB-PA643571LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AAK1. Recognizes AAK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

AAK1 Antibody

CSB-PA903610-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against AAK1. Recognizes AAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

AAK1 Antibody

CSB-PA903610-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against AAK1. Recognizes AAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

AAK1 Antibody

DF3309 200ul
EUR 304
Description: AAK1 Antibody detects endogenous levels of total AAK1.

AAK1 Antibody

CSB-PA183703-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.1mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against AAK1. Recognizes AAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

AAK1 Antibody

CSB-PA183703-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.1mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against AAK1. Recognizes AAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

Aak1 antibody

70R-9305 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Aak1 antibody

AAK1 antibody

70R-9306 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AAK1 antibody

AAK1 Antibody

AF0685 200ul
EUR 304
Description: AAK1 Antibody detects endogenous levels of AAK1.

AAK1 Antibody

abx332023-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

AAK1 siRNA

20-abx906252
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AAK1 siRNA

20-abx906253
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AAK1 Antibody

ABD3309 100 ug
EUR 438

AAK1 Antibody

ABF0685 100 ug
EUR 438

anti-AAK1

YF-PA17636 50 ul
EUR 363
Description: Mouse polyclonal to AAK1

LKB1 Antibody

24473-100ul 100ul
EUR 390

LKB1 antibody

70R-12216 100 ug
EUR 403
Description: Rabbit polyclonal LKB1 antibody

LKB1 Antibody

3950-100
EUR 316

LKB1 Antibody

3950-30T
EUR 146

LKB1 antibody

70R-35092 100 ug
EUR 327
Description: Purified Rabbit polyclonal LKB1 antibody

LKB1 antibody

70R-35972 100 ug
EUR 327
Description: Rabbit polyclonal LKB1 antibody

LKB1 antibody

70R-50441 100 ul
EUR 287
Description: Purified Polyclonal LKB1 antibody

LKB1 antibody

70R-51648 100 ul
EUR 244
Description: Purified Polyclonal LKB1 antibody

LKB1 antibody

70R-51649 100 ul
EUR 244
Description: Purified Polyclonal LKB1 antibody

LKB1 antibody

70R-32666 100 ug
EUR 327
Description: Rabbit polyclonal LKB1 antibody

LKB1 Antibody

AF6453 200ul
EUR 304
Description: LKB1 Antibody detects endogenous levels of total LKB1.

LKB1 Antibody

AF6454 200ul
EUR 304
Description: LKB1 Antibody detects endogenous levels of total LKB1.

LKB1 Antibody

AF7898 200ul
EUR 376
Description: LKB1 Antibody detects endogenous levels of LKB1.

LKB1 Antibody

ABF6453 100 ug
EUR 438

LKB1 Antibody

ABF6454 100 ug
EUR 438

anti-LKB1

YF-PA14845 50 ug
EUR 363
Description: Mouse polyclonal to LKB1

anti-LKB1

YF-PA14846 100 ug
EUR 403
Description: Rabbit polyclonal to LKB1

anti-LKB1

YF-PA24788 50 ul
EUR 334
Description: Mouse polyclonal to LKB1

AAK1 Blocking Peptide

33R-10925 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AAK1 antibody, catalog no. 70R-12106

Aak1 Blocking Peptide

33R-1440 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Aak1 antibody, catalog no. 70R-9305

AAK1 Blocking Peptide

33R-8453 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AAK1 antibody, catalog no. 70R-9306

AAK1 Blocking Peptide

3810BP-50
EUR 153

AAK1 Blocking Peptide

DF3309-BP 1mg
EUR 195

Polyclonal Aak1 Antibody

APR14750G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Aak1 . This antibody is tested and proven to work in the following applications:

Polyclonal Aak1 Antibody

APR14751G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Aak1 . This antibody is tested and proven to work in the following applications:

AAK1 Blocking Peptide

AF0685-BP 1mg
EUR 195

AAK1 Conjugated Antibody

C33919 100ul
EUR 397

AAK1 cloning plasmid

CSB-CL643571HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1423
  • Sequence: atgaagaagtttttcgactcccggcgagagcagggcggctctggcctgggctccggctccagcggaggagggggcagcacctcgggcctgggcagtggctacatcggaagagtcttcggcatcgggcgacagcaggtcacagtggacgaggtgttggcggaaggtggatttgcta
  • Show more
Description: A cloning plasmid for the AAK1 gene.

AAK1 Polyclonal Antibody

ABP50558-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AAK1 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of AAK1 from Human, Mouse, Rat, Monkey. This AAK1 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AAK1 at AA range: 240-320

AAK1 Polyclonal Antibody

ABP50558-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AAK1 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of AAK1 from Human, Mouse, Rat, Monkey. This AAK1 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AAK1 at AA range: 240-320

AAK1 Polyclonal Antibody

ABP50558-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AAK1 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of AAK1 from Human, Mouse, Rat, Monkey. This AAK1 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AAK1 at AA range: 240-320

AAK1 Polyclonal Antibody

ES1557-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AAK1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

AAK1 Polyclonal Antibody

ES1557-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AAK1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-AAK1 antibody

STJ91403 200 µl
EUR 197
Description: Rabbit polyclonal to AAK1.

LKB1 AAK1 dual inhibitor