Leukemia FIP1L1-PDGFRA Fusion Gene Real

Leukemia FIP1L1-PDGFRA Fusion Gene Real 

To Order Contact us: caitlyn@ucb-bioproducts.com

Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

EUR 495
  • Should the Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

EUR 644
  • Should the Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RD-PDGFRa-Hu-48Tests 48 Tests
EUR 460

Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RD-PDGFRa-Hu-96Tests 96 Tests
EUR 636

Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RD-PDGFRa-Ra-48Tests 48 Tests
EUR 496

Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RD-PDGFRa-Ra-96Tests 96 Tests
EUR 688

Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RDR-PDGFRa-Hu-48Tests 48 Tests
EUR 481

Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RDR-PDGFRa-Hu-96Tests 96 Tests
EUR 665

Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RDR-PDGFRa-Ra-48Tests 48 Tests
EUR 519

Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit

RDR-PDGFRa-Ra-96Tests 96 Tests
EUR 720

Fip1l1/ Rat Fip1l1 ELISA Kit

ELI-26706r 96 Tests
EUR 886

Tcf3 (E2A) Fusion Partner (In Childhood Leukemia) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FIP1L1 antibody

70R-4866 50 ug
EUR 467
Description: Rabbit polyclonal FIP1L1 antibody

Human Homeobox Gene Primer Library

HHOX-I 1 set
EUR 645

Human Retinoblastoma Gene Primer Library

HRBG-I 1 set
EUR 548

Human Leukemia NUP98 fusion partner 1, LNP1 ELISA KIT

ELI-12622h 96 Tests
EUR 824

anti- FIP1L1 antibody

FNab03131 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: FIP1 like 1 (S. cerevisiae)
  • Uniprot ID: Q6UN15
  • Gene ID: 81608
  • Research Area: Epigenetics
Description: Antibody raised against FIP1L1

FIP1L1 Rabbit pAb

A7138-100ul 100 ul
EUR 308

FIP1L1 Rabbit pAb

A7138-200ul 200 ul
EUR 459

FIP1L1 Rabbit pAb

A7138-20ul 20 ul
EUR 183

FIP1L1 Rabbit pAb

A7138-50ul 50 ul
EUR 223

FIP1L1 Rabbit pAb

A5016-100ul 100 ul
EUR 308

FIP1L1 Rabbit pAb

A5016-200ul 200 ul
EUR 459

FIP1L1 Rabbit pAb

A5016-20ul 20 ul
EUR 183

FIP1L1 Rabbit pAb

A5016-50ul 50 ul
EUR 223

FIP1L1 Blocking Peptide

33R-2814 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FIP1L1 antibody, catalog no. 70R-4866

FIP1L1 Polyclonal Antibody

30835-100ul 100ul
EUR 252

FIP1L1 Polyclonal Antibody

30835-50ul 50ul
EUR 187

FIP1L1 cloning plasmid

CSB-CL744253HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgtcggccggcgaggtcgagcgcctagtgtcggagctgagcggcgggaccggaggggatgaggaggaagagtggctctatggcgatgaaaatgaagttgaaaggccagaagaagaaaatgccagtgctaatcctccatctggaattgaagatgaaactgctgaaaatggtgtac
  • Show more
Description: A cloning plasmid for the FIP1L1 gene.

FIP1L1 cloning plasmid

CSB-CL744253HU2-10ug 10ug
EUR 580
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1680
  • Show more
Description: A cloning plasmid for the FIP1L1 gene.

FIP1L1 cloning plasmid

CSB-CL744253HU3-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1785
  • Show more
Description: A cloning plasmid for the FIP1L1 gene.

Anti-FIP1L1 antibody

PAab03131 100 ug
EUR 386

Anti-FIP1L1 antibody

STJ29218 100 µl
EUR 277
Description: This gene encodes a subunit of the CPSF (cleavage and polyadenylation specificity factor) complex that polyadenylates the 3' end of mRNA precursors. This gene, the homolog of yeast Fip1 (factor interacting with PAP), binds to U-rich sequences of pre-mRNA and stimulates poly(A) polymerase activity. Its N-terminus contains a PAP-binding site and its C-terminus an RNA-binding domain. An interstitial chromosomal deletion on 4q12 creates an in-frame fusion of human genes FIP1L1 and PDGFRA (platelet-derived growth factor receptor, alpha). The FIP1L1-PDGFRA fusion gene encodes a constitutively activated tyrosine kinase that joins the first 233 amino acids of FIP1L1 to the last 523 amino acids of PDGFRA. This gene fusion and chromosomal deletion is the cause of some forms of idiopathic hypereosinophilic syndrome (HES). This syndrome, recently reclassified as chronic eosinophilic leukemia (CEL), is responsive to treatment with tyrosine kinase inhibitors. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-FIP1L1 antibody

STJ11100907 100 µl
EUR 277
Description: This gene encodes a subunit of the CPSF (cleavage and polyadenylation specificity factor) complex that polyadenylates the 3' end of mRNA precursors. This gene, the homolog of yeast Fip1 (factor interacting with PAP), binds to U-rich sequences of pre-mRNA and stimulates poly(A) polymerase activity. Its N-terminus contains a PAP-binding site and its C-terminus an RNA-binding domain. An interstitial chromosomal deletion on 4q12 creates an in-frame fusion of human genes FIP1L1 and PDGFRA (platelet-derived growth factor receptor, alpha). The FIP1L1-PDGFRA fusion gene encodes a constitutively activated tyrosine kinase that joins the first 233 amino acids of FIP1L1 to the last 523 amino acids of PDGFRA. This gene fusion and chromosomal deletion is the cause of some forms of idiopathic hypereosinophilic syndrome (HES). This syndrome, recently reclassified as chronic eosinophilic leukemia (CEL), is responsive to treatment with tyrosine kinase inhibitors. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-FIP1L1 (2H4)

YF-MA19437 100 ug
EUR 363
Description: Mouse monoclonal to FIP1L1

Leukemia FIP1L1-PDGFRA Fusion Gene Real