Leukemia FIP1L1-PDGFRA Fusion Gene Real
Leukemia FIP1L1-PDGFRA Fusion Gene Real
Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
DLR-PDGFRa-Ra-48T |
DL Develop |
48T |
EUR 495 |
- Should the Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
DLR-PDGFRa-Ra-96T |
DL Develop |
96T |
EUR 644 |
- Should the Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RD-PDGFRa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 460 |
Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RD-PDGFRa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 636 |
Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RD-PDGFRa-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 496 |
Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RD-PDGFRa-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 688 |
Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RDR-PDGFRa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 481 |
Human Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RDR-PDGFRa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 665 |
Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RDR-PDGFRa-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 519 |
Rat Platelet Derived Growth Factor Receptor Alpha (PDGFRa) ELISA Kit |
RDR-PDGFRa-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 720 |
Tcf3 (E2A) Fusion Partner (In Childhood Leukemia) Antibody |
20-abx116014 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FIP1L1 siRNA |
20-abx901972 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FIP1L1 siRNA |
20-abx916910 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FIP1L1 siRNA |
20-abx916911 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FIP1L1 antibody |
70R-4866 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FIP1L1 antibody |
Human Leukemia NUP98 fusion partner 1, LNP1 ELISA KIT |
ELI-12622h |
Lifescience Market |
96 Tests |
EUR 824 |
anti- FIP1L1 antibody |
FNab03131 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:100
- Immunogen: FIP1 like 1 (S. cerevisiae)
- Uniprot ID: Q6UN15
- Gene ID: 81608
- Research Area: Epigenetics
|
Description: Antibody raised against FIP1L1 |
FIP1L1 Rabbit pAb |
A7138-100ul |
Abclonal |
100 ul |
EUR 308 |
FIP1L1 Rabbit pAb |
A7138-200ul |
Abclonal |
200 ul |
EUR 459 |
FIP1L1 Rabbit pAb |
A7138-20ul |
Abclonal |
20 ul |
EUR 183 |
FIP1L1 Rabbit pAb |
A7138-50ul |
Abclonal |
50 ul |
EUR 223 |
FIP1L1 Rabbit pAb |
A5016-100ul |
Abclonal |
100 ul |
EUR 308 |
FIP1L1 Rabbit pAb |
A5016-200ul |
Abclonal |
200 ul |
EUR 459 |
FIP1L1 Rabbit pAb |
A5016-20ul |
Abclonal |
20 ul |
EUR 183 |
FIP1L1 Rabbit pAb |
A5016-50ul |
Abclonal |
50 ul |
EUR 223 |
FIP1L1 Blocking Peptide |
33R-2814 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FIP1L1 antibody, catalog no. 70R-4866 |
FIP1L1 Polyclonal Antibody |
30835-100ul |
SAB |
100ul |
EUR 252 |
FIP1L1 Polyclonal Antibody |
30835-50ul |
SAB |
50ul |
EUR 187 |
FIP1L1 cloning plasmid |
CSB-CL744253HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1137
- Sequence: atgtcggccggcgaggtcgagcgcctagtgtcggagctgagcggcgggaccggaggggatgaggaggaagagtggctctatggcgatgaaaatgaagttgaaaggccagaagaagaaaatgccagtgctaatcctccatctggaattgaagatgaaactgctgaaaatggtgtac
- Show more
|
Description: A cloning plasmid for the FIP1L1 gene. |
FIP1L1 cloning plasmid |
CSB-CL744253HU2-10ug |
Cusabio |
10ug |
EUR 580 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1680
- Sequence: ATGATCACTTCAGATTTTCATAATACTAGTTTCTTTAAGAGTGGTTTCTTTATTTTGTTTGCTTATTTATTTATTTGTTTATTTTACTTGGTAGATGAAAATGAAGTTGAAAGGCCAGAAGAAGAAAATGCCAGTGCTAATCCTCCATCTGGAATTGAAGATGAAACTGCTGAAA
- Show more
|
Description: A cloning plasmid for the FIP1L1 gene. |
FIP1L1 cloning plasmid |
CSB-CL744253HU3-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1785
- Sequence: ATGTCGGCCGGCGAGGTCGAGCGCCTAGTGTCGGAGCTGAGCGGCGGGACCGGAGGGGATGAGGAGGAAGAGTGGCTCTATGGCGGCCCATGGGACGTGCATGTGCACAGTGATTTGGCAAAGGACCTAGATGAAAATGAAGTTGAAAGGCCAGAAGAAGAAAATGCCAGTGCTA
- Show more
|
Description: A cloning plasmid for the FIP1L1 gene. |
Anti-FIP1L1 antibody |
STJ29218 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the CPSF (cleavage and polyadenylation specificity factor) complex that polyadenylates the 3' end of mRNA precursors. This gene, the homolog of yeast Fip1 (factor interacting with PAP), binds to U-rich sequences of pre-mRNA and stimulates poly(A) polymerase activity. Its N-terminus contains a PAP-binding site and its C-terminus an RNA-binding domain. An interstitial chromosomal deletion on 4q12 creates an in-frame fusion of human genes FIP1L1 and PDGFRA (platelet-derived growth factor receptor, alpha). The FIP1L1-PDGFRA fusion gene encodes a constitutively activated tyrosine kinase that joins the first 233 amino acids of FIP1L1 to the last 523 amino acids of PDGFRA. This gene fusion and chromosomal deletion is the cause of some forms of idiopathic hypereosinophilic syndrome (HES). This syndrome, recently reclassified as chronic eosinophilic leukemia (CEL), is responsive to treatment with tyrosine kinase inhibitors. Alternative splicing results in multiple transcript variants encoding distinct isoforms. |
Anti-FIP1L1 antibody |
STJ11100907 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the CPSF (cleavage and polyadenylation specificity factor) complex that polyadenylates the 3' end of mRNA precursors. This gene, the homolog of yeast Fip1 (factor interacting with PAP), binds to U-rich sequences of pre-mRNA and stimulates poly(A) polymerase activity. Its N-terminus contains a PAP-binding site and its C-terminus an RNA-binding domain. An interstitial chromosomal deletion on 4q12 creates an in-frame fusion of human genes FIP1L1 and PDGFRA (platelet-derived growth factor receptor, alpha). The FIP1L1-PDGFRA fusion gene encodes a constitutively activated tyrosine kinase that joins the first 233 amino acids of FIP1L1 to the last 523 amino acids of PDGFRA. This gene fusion and chromosomal deletion is the cause of some forms of idiopathic hypereosinophilic syndrome (HES). This syndrome, recently reclassified as chronic eosinophilic leukemia (CEL), is responsive to treatment with tyrosine kinase inhibitors. Alternative splicing results in multiple transcript variants encoding distinct isoforms. |
Anti-FIP1L1 (2H4) |
YF-MA19437 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FIP1L1 |
Leukemia FIP1L1-PDGFRA Fusion Gene Real