Insights on Well being and Meals Purposes of Equus asinus (Donkey) Milk Bioactive Proteins and Peptides

ucb-bioproducts

Insights on Well being and Meals Purposes of Equus asinus (Donkey) Milk Bioactive Proteins and Peptides-An Overview

As a consequence of its similarity with human milk and its low allergenic properties, donkey milk has lengthy been used as a substitute for infants and sufferers with cow’s milk protein allergy (CMPA). As well as, this milk is attracting rising curiosity in human diet due to presumed well being advantages.

It has antioxidant, antimicrobial, antitumoral, antiproliferative and antidiabetic exercise. As well as, it stimulates the immune system, regulates the gastrointestinal flora, and prevents inflammatory ailments. Though all donkey milk elements can contribute to practical and dietary results, it’s typically accepted that the whey protein fraction performs a major position.

This overview goals to spotlight the energetic proteins and peptides of donkey milk as compared with different kinds of milk, emphasizing their properties and their roles in several fields of well being and meals functions. 

ucb-bioproducts
ucb-bioproducts
SIPA1L2 Antibody
25007-100ul 100ul
EUR 390
SIPA1L2 antibody
70R-20276 50 ul
EUR 435
Description: Rabbit polyclonal SIPA1L2 antibody
SIPA1L2 siRNA
20-abx933388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SIPA1L2 siRNA
20-abx933389
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SIPA1L2 Antibody
1-CSB-PA882179LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SIPA1L2. Recognizes SIPA1L2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SIPA1L2 Antibody
1-CSB-PA021332GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SIPA1L2. Recognizes SIPA1L2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
anti-SIPA1L2
YF-PA20224 50 ul
EUR 363
Description: Mouse polyclonal to SIPA1L2
Polyclonal SIPA1L2 Antibody
APR06586G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SIPA1L2 . This antibody is tested and proven to work in the following applications:
SIPA1L2 Antibody (HRP)
20-abx311693
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SIPA1L2 Antibody (FITC)
20-abx311694
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SIPA1L2 Antibody (Biotin)
20-abx311695
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SIPA1L2 Polyclonal Antibody
A60914 100 µg
EUR 570.55
Description: kits suitable for this type of research
SIPA1L2 cloning plasmid
CSB-CL882179HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1599
  • Sequence: atggaagcaagcaggcacccggaaaccaaatggcatggcccaccttccaaagtcctgggttcctataaagaaagagctctgcagaaagatggaagttgcaaagattcccccaataagctttctcacattggggataaaagttgctccagtcactccagcagcaacacgctctcca
  • Show more
Description: A cloning plasmid for the SIPA1L2 gene.
Rat SIPA1L2 shRNA Plasmid
20-abx990201
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SIPA1L2 shRNA Plasmid
20-abx982715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SIPA1L2 ELISA KIT
ELI-18663h 96 Tests
EUR 824
Mouse Sipa1l2 ELISA KIT
ELI-40844m 96 Tests
EUR 865
Human SIPA1L2 shRNA Plasmid
20-abx961542
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SIPA1L2 Antibody, HRP conjugated
1-CSB-PA882179LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SIPA1L2. Recognizes SIPA1L2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SIPA1L2 Antibody, FITC conjugated
1-CSB-PA882179LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SIPA1L2. Recognizes SIPA1L2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SIPA1L2 Antibody, Biotin conjugated
1-CSB-PA882179LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SIPA1L2. Recognizes SIPA1L2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal SIPA1L2 Antibody (N-Terminus)
APR02720G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SIPA1L2 (N-Terminus). This antibody is tested and proven to work in the following applications:
SIPA1L2 Polyclonal Antibody, Biotin Conjugated
A60915 100 µg
EUR 570.55
Description: fast delivery possible
SIPA1L2 Polyclonal Antibody, FITC Conjugated
A60916 100 µg
EUR 570.55
Description: reagents widely cited
SIPA1L2 Polyclonal Antibody, HRP Conjugated
A60917 100 µg
EUR 570.55
Description: Ask the seller for details
SIPA1L2 ORF Vector (Human) (pORF)
ORF009527 1.0 ug DNA
EUR 95
Sipa1l2 ORF Vector (Mouse) (pORF)
ORF057315 1.0 ug DNA
EUR 1572
Sipa1l2 ORF Vector (Rat) (pORF)
ORF076255 1.0 ug DNA
EUR 2080
SIPA1L2 sgRNA CRISPR Lentivector set (Human)
K2151101 3 x 1.0 ug
EUR 339
Sipa1l2 sgRNA CRISPR Lentivector set (Rat)
K6366001 3 x 1.0 ug
EUR 339
Sipa1l2 sgRNA CRISPR Lentivector set (Mouse)
K3888801 3 x 1.0 ug
EUR 339
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 533
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 740
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 557
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 774
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672
SIPA1L2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2151102 1.0 ug DNA
EUR 154
SIPA1L2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2151103 1.0 ug DNA
EUR 154
SIPA1L2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2151104 1.0 ug DNA
EUR 154
Sipa1l2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6366002 1.0 ug DNA
EUR 154
Sipa1l2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6366003 1.0 ug DNA
EUR 154
Sipa1l2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6366004 1.0 ug DNA
EUR 154
Sipa1l2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3888802 1.0 ug DNA
EUR 154
Sipa1l2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3888803 1.0 ug DNA
EUR 154
Sipa1l2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3888804 1.0 ug DNA
EUR 154
SIPA1L2 Protein Vector (Human) (pPB-C-His)
PV038105 500 ng
EUR 329
SIPA1L2 Protein Vector (Human) (pPB-N-His)
PV038106 500 ng
EUR 329
SIPA1L2 Protein Vector (Human) (pPM-C-HA)
PV038107 500 ng
EUR 329
SIPA1L2 Protein Vector (Human) (pPM-C-His)
PV038108 500 ng
EUR 329
SIPA1L2 Protein Vector (Rat) (pPB-C-His)
PV305018 500 ng
EUR 2876
SIPA1L2 Protein Vector (Rat) (pPB-N-His)
PV305019 500 ng
EUR 2876
SIPA1L2 Protein Vector (Rat) (pPM-C-HA)
PV305020 500 ng
EUR 2876
SIPA1L2 Protein Vector (Rat) (pPM-C-His)
PV305021 500 ng
EUR 2876
SIPA1L2 Protein Vector (Mouse) (pPB-C-His)
PV229258 500 ng
EUR 2876
SIPA1L2 Protein Vector (Mouse) (pPB-N-His)
PV229259 500 ng
EUR 2876
SIPA1L2 Protein Vector (Mouse) (pPM-C-HA)
PV229260 500 ng
EUR 2876
SIPA1L2 Protein Vector (Mouse) (pPM-C-His)
PV229261 500 ng
EUR 2876
Sipa1l2 3'UTR GFP Stable Cell Line
TU168833 1.0 ml Ask for price
SIPA1L2 3'UTR Luciferase Stable Cell Line
TU023216 1.0 ml
EUR 1394
Sipa1l2 3'UTR Luciferase Stable Cell Line
TU118833 1.0 ml Ask for price
SIPA1L2 3'UTR GFP Stable Cell Line
TU073216 1.0 ml
EUR 1394
Sipa1l2 3'UTR Luciferase Stable Cell Line
TU220377 1.0 ml Ask for price
Sipa1l2 3'UTR GFP Stable Cell Line
TU270377 1.0 ml Ask for price
SIPA1L2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV659839 1.0 ug DNA
EUR 2680
SIPA1L2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV659843 1.0 ug DNA
EUR 2680
SIPA1L2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV659844 1.0 ug DNA
EUR 2680
Signal-Induced Proliferation-Associated 1-Like Protein 2 (SIPA1L2) Antibody
20-abx115564
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal-Induced Proliferation-Associated 1-Like Protein 2 (SIPA1L2) Antibody
20-abx301721
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SIPA1L2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2151105 3 x 1.0 ug
EUR 376
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6366005 3 x 1.0 ug
EUR 376
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3888805 3 x 1.0 ug
EUR 376
SIPA1L2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2151106 1.0 ug DNA
EUR 167
SIPA1L2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2151107 1.0 ug DNA
EUR 167
SIPA1L2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2151108 1.0 ug DNA
EUR 167
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6366006 1.0 ug DNA
EUR 167
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6366007 1.0 ug DNA
EUR 167
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6366008 1.0 ug DNA
EUR 167
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3888806 1.0 ug DNA
EUR 167
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3888807 1.0 ug DNA
EUR 167
Sipa1l2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3888808 1.0 ug DNA
EUR 167
SIPA1L2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV659840 1.0 ug DNA
EUR 2680
SIPA1L2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV659841 1.0 ug DNA
EUR 2738
SIPA1L2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV659842 1.0 ug DNA
EUR 2738
Human Connecting Peptide (C-Peptide) Peptide
abx670072-05mg 0.5 mg
EUR 565
  • Shipped within 1 week.
TKD Peptide (Hsp70 Peptide) (Hsp70 Peptide)
SIH-118A 1 mg
EUR 312
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide) is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.
Rat Connecting Peptide (C-Peptide) Peptide (OVA)
20-abx651058
  • EUR 425.00
  • EUR 230.00
  • EUR 1149.00
  • EUR 495.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TKD Peptide (Hsp70 Peptide): FITC (Hsp70 Peptide)
SIH-119A 1 mg
EUR 359
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide): FITC is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.
TKD Peptide (Hsp70 Peptide)
abx076809-1mg 1 mg
EUR 495
  • Shipped within 5-12 working days.
C-Peptide Blocking Peptide
3277BP-50
EUR 153
Human Peptide YY (PYY) Peptide
20-abx068451
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Peptide YY (PYY) Peptide
20-abx068452
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Peptide YY (PYY) Peptide
20-abx068453
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TKD Peptide (Hsp70 Peptide) (FITC)
abx076810-1mg 1 mg
EUR 565
  • Shipped within 5-12 working days.
Connecting Peptide (C-Peptide) Antibody
20-abx100155
  • EUR 258.00
  • EUR 133.00
  • EUR 606.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Connecting Peptide (C-Peptide) Antibody
abx021134-100ug 100 ug
EUR 481
  • Shipped within 5-10 working days.
Connecting Peptide (C-Peptide) Antibody
abx021135-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.
Connecting Peptide (C-Peptide) Antibody
abx022864-01ml 0.1 ml
EUR 578
  • Shipped within 5-10 working days.
Connecting Peptide (C-peptide) Antibody
abx023812-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.
Connecting Peptide (C-Peptide) Antibody
abx411178-025mg 0.25 mg
EUR 565
  • Shipped within 1 week.
Connecting Peptide (C-Peptide) Antibody
abx414631-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Connecting Peptide (C-Peptide) Antibody
abx414632-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Connecting Peptide (C-Peptide) Antibody
abx414633-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Connecting Peptide (C-Peptide) Antibody
abx414789-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Connecting Peptide (C-Peptide) Antibody
abx414790-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Human Brain natriuretic peptide (BNP) Peptide
abx670010-01mg 0.1 mg
EUR 300
  • Shipped within 1 week.
Rat Galanin Like Peptide (GALP) Peptide
20-abx650475
  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Vasoactive Intestinal Peptide (VIP) Peptide (OVA)
20-abx651057
  • EUR 411.00
  • EUR 217.00
  • EUR 1080.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dog Peptide YY (PYY) Peptide (OVA)
20-abx651198
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Peptide YY (PYY) Peptide (OVA)
20-abx651199
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pig Peptide YY (PYY) Peptide (OVA)
20-abx651200
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Peptide YY (PYY) Peptide (OVA)
20-abx651201
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human C-Peptide (CP) Peptide (OVA)
20-abx651801
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Peptide YY (PYY) Peptide (OVA)
20-abx651848
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Atrial Natriuretic Peptide (ANP) Peptide
20-abx652084
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Rat Brain Natriuretic Peptide (BNP) Peptide
20-abx652109
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Vasoactive Intestinal Peptide (VIP) Peptide
20-abx652275
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Osteogenic Growth Peptide (OGP) Peptide
20-abx652290
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Atrial Natriuretic Peptide (ANP) Peptide
20-abx065482
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Rat Atrial Natriuretic Peptide (ANP) Peptide
20-abx065483
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Curcumin Inhibits the Major Nucleation of Amyloid-Beta Peptide: A Molecular Dynamics Examine

The amyloid plaques are a key hallmark of neurodegenerative ailments akin to Alzheimer’s illness and Parkinson’s illness. Amyloidogenesis is a fancy long-lasting multiphase course of beginning with the formation of nuclei of amyloid peptides: a course of assigned as a main nucleation. Curcumin (CU) is a well known inhibitor of the aggregation of amyloid-beta (Aβ) peptides. Much more, CU is ready to disintegrate preformed Aβ firbils and amyloid plaques.

Right here, we simulate by molecular dynamics the first nucleation strategy of 12 Aβ peptides and examine the results of CU on the method. We discovered that CU molecules intercalate among the many Aβ chains and bind tightly to them by hydrogen bonds, hydrophobic, π-π, and cation-π interactions. Within the presence of CU, the Aβ peptides type a main nucleus of a much bigger measurement. The peptide chains within the nucleus develop into much less versatile and extra disordered, and the variety of non-native contacts and hydrogen bonds between them decreases.

For comparability, the results of the weaker Aβ inhibitor ferulic acid (FA) on the first nucleation are additionally examined. Our research is in good settlement with the remark that taken often, CU is ready to forestall or no less than delay the onset of neurodegenerative issues. 

Tape stripping methodology is helpful for the quantification of antimicrobial peptides on the human pores and skin floor together with the stratum corneum

Antimicrobial peptides (AMPs) play an necessary position in innate immunity in human pores and skin. It’s recognized that AMPs primarily operate within the stratum corneum. Due to this fact, AMP concentrations within the stratum corneum should be exactly measured to make clear practical and physiological significance of AMPs in cutaneous defence. Tape stripping (TS) is a well-established methodology by which elements within the stratum corneum might be collected.

Nonetheless, the usefulness of the TS methodology for measuring AMP focus in human pores and skin stays unclear. Due to this fact, we in contrast it with one other common methodology, pores and skin rinsing, which had been established as a way for measuring AMP focus in human pores and skin. When investigated on wholesome medial forearm utilizing RNase 7, which is among the typical AMPs, as an index, there was a major optimistic correlation between RNase 7 concentrations measured by the TS methodology at adjoining forearm websites, demonstrating the reproducibility of the TS methodology.

Subsequent, a major optimistic correlation was detected in RNase 7 concentrations measured utilizing the TS and the pores and skin rinsing methodology, indicating that the TS methodology is similar to the pores and skin rinsing methodology. Thus, we speculate that the TS methodology is helpful for measuring AMP focus in human pores and skin.

Anti-Osteoporotic Results of Antioxidant Peptides PIISVYWK and FSVVPSPK from Mytilus edulis on Ovariectomized Mice

Quite a few quantities of proof recommend that bioactive peptides with numerous physiological actions might be nutraceuticals or potential drug candidates. On this research, blue mussel-derived antioxidant peptides PIISVYWK and FSVVPSPK have been subjected to guage their osteogenic impact in mouse bone marrow mesenchymal stem cells (mBMMSCs) adopted by an in vivo anti-osteoporotic impact.

Remedy of PIISVYWK and FSVVPSPK on mBMMSCs stimulated alkaline phosphatase exercise and calcification. Western blot outcomes revealed that PIISVYWK and FSVVPSPK elevated the expression of bone morphogenetic protein-2/4 (BMP-2/4) adopted by upregulating p-Smad1/5, kind I collagen, and transcription components together with Runx2 and osterix in mBMMSCs.

Two peptides additionally activated the phosphorylation of MAPKs (p-p38, p-ERK, and p-JNK). Remedy of MAPK inhibitors considerably inhibited the BMP signaling pathway, indicating that PIISVYWK and FSVVPSPK stimulated osteoblast differentiation of mBMMSCs by way of the MAPK-dependent BMP signaling pathway. The anti-osteoporotic impact of PIISVYWK and FSVVPSPK in ovariectomized (OVX) mice was investigated.

Remedy of PIISVYWK and FSVVPSPK for ten weeks confirmed a notable anti-osteoporotic impact in OVX mice by way of growing bone mineral density and different bone parameters in comparison with OVX mice with out peptides. Serum evaluation additionally confirmed that therapy of PIISVYWK and FSVVPSPK utterly decreased osteocalcin and ALP (alkAline phosphatase) exercise. Taken collectively, these outcomes recommend that PIISVYWK and FSVVPSPK might be health-promoting practical meals substances in opposition to osteoporosis.

TACE Antibody

3222R-100
EUR 338

TACE Antibody

3222R-30T
EUR 146

TACE (ADAM-17)

5-01998 4 x 1mg Ask for price

Polyclonal TACE Antibody

APR10372G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TACE . This antibody is tested and proven to work in the following applications:

Polyclonal TACE Antibody

APR10373G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TACE . This antibody is tested and proven to work in the following applications:

Polyclonal TACE Antibody

APR10374G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TACE . This antibody is tested and proven to work in the following applications:

TACE Polyclonal Antibody

ABP56333-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TACE around the non-phosphorylation site of T735
  • Applications tips:
Description: A polyclonal antibody for detection of TACE from Human, Mouse, Rat. This TACE antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TACE around the non-phosphorylation site of T735

TACE Polyclonal Antibody

ABP56333-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TACE around the non-phosphorylation site of T735
  • Applications tips:
Description: A polyclonal antibody for detection of TACE from Human, Mouse, Rat. This TACE antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TACE around the non-phosphorylation site of T735

TACE Polyclonal Antibody

ABP56333-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TACE around the non-phosphorylation site of T735
  • Applications tips:
Description: A polyclonal antibody for detection of TACE from Human, Mouse, Rat. This TACE antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TACE around the non-phosphorylation site of T735

TACE Polyclonal Antibody

ES7332-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TACE from Human/Mouse/Rat. This antibody is tested and validated for IF, WB, ELISA

TACE Polyclonal Antibody

ES7332-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TACE from Human/Mouse/Rat. This antibody is tested and validated for IF, WB, ELISA

Anti-TACE antibody

STJ95888 200 µl
EUR 197
Description: Rabbit polyclonal to TACE.

Rat TNF-alpha Converting Enzyme (TACE) Control/blocking peptide

TACE11-P 100 ug
EUR 164

Alpha-Secretase peptide substrate Human APP605-619, >95% pure

TACE-SW-1 1 mg
EUR 354

Alpha-Secretase peptide substrate Human APP605-619, >95% pure

TACE-SW-10 10 mg
EUR 1207

Alpha-Secretase peptide substrate Human APP605-619, >95% pure

TACE-SW-20 20 mg
EUR 1937

TACE (human) ELISA Kit

K4754-100 100 assays
EUR 1108
  • Kit components:
Description: Sensitive, Colorimetric Assay

Anti-ADAM17 / TACE antibody

STJ70149 100 µg
EUR 359

Cleaved-TACE (R215) Polyclonal Antibody

ABP56331-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TACE at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-TACE R215) from Human. This Cleaved-TACE R215) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TACE at AA range: 170-250

Cleaved-TACE (R215) Polyclonal Antibody

ABP56331-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TACE at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-TACE R215) from Human. This Cleaved-TACE R215) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TACE at AA range: 170-250

Cleaved-TACE (R215) Polyclonal Antibody

ABP56331-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TACE at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-TACE R215) from Human. This Cleaved-TACE R215) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TACE at AA range: 170-250

TACE (phospho Thr735) Polyclonal Antibody

ABP56332-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TACE around the phosphorylation site of T735
  • Applications tips:
Description: A polyclonal antibody for detection of TACE phospho Thr735) from Human, Mouse, Rat. This TACE phospho Thr735) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TACE around the phosphorylation site of T735

TACE (phospho Thr735) Polyclonal Antibody

ABP56332-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TACE around the phosphorylation site of T735
  • Applications tips:
Description: A polyclonal antibody for detection of TACE phospho Thr735) from Human, Mouse, Rat. This TACE phospho Thr735) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TACE around the phosphorylation site of T735

TACE (phospho Thr735) Polyclonal Antibody

ABP56332-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TACE around the phosphorylation site of T735
  • Applications tips:
Description: A polyclonal antibody for detection of TACE phospho Thr735) from Human, Mouse, Rat. This TACE phospho Thr735) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TACE around the phosphorylation site of T735

Cleaved-TACE (R215) Polyclonal Antibody

ES7330-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cleaved-TACE (R215) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-TACE (R215) Polyclonal Antibody

ES7330-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cleaved-TACE (R215) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TACE (phospho Thr735) Polyclonal Antibody

ES7331-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TACE (phospho Thr735) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TACE (phospho Thr735) Polyclonal Antibody

ES7331-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TACE (phospho Thr735) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-Cleaved-TACE (R215) antibody

STJ90075 200 µl
EUR 197
Description: Rabbit polyclonal to Cleaved-TACE (R215).

Anti-Phospho-TACE (T735) antibody

STJ90495 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-TACE (T735).

TACE (TNF-? converting enzyme), human recombinant

7607-100
EUR 1186

TACE (TNF-? converting enzyme), human recombinant

7607-1000
EUR 6841

TACE (TNF-? converting enzyme), human recombinant

7607-20
EUR 370

Polyclonal ADAM17 / TACE Antibody (aa807-823)

APG01548G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (aa807-823). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (C-Terminus)

APG01549G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (C-Terminus)

APG01550G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-ADAM17 / TACE Antibody

AMM04866G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ADAM17 / TACE . This antibody is tested and proven to work in the following applications:

TACE Inhibitor Screening Assay Kit ( Fluorometric)

K366-100
EUR 588

Anti-ADAM17/Tace Rabbit Monoclonal Antibody

M00604 100ug/vial
EUR 397
Description: Rabbit Monoclonal ADAM17/Tace Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human, Mouse, Rat.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643

Human TNF ? converting enzyme,TACE ELISA Kit

201-12-0849 96 tests
EUR 440
  • This TNF alpha converting enzyme ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Purified, recombinant Human TACE control protein (active)

TACE15-R-10 10 ug
EUR 712

ELISA kit for Human TACE (TNF ? Converting Enzyme)

E-EL-H2305 1 plate of 96 wells
EUR 534
  • Gentaur's TACE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TACE. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TACE (TNF ? Converting Enzyme) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat TACE (TNF ? Converting Enzyme)

E-EL-R0865 1 plate of 96 wells
EUR 534
  • Gentaur's TACE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TACE. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat TACE (TNF ? Converting Enzyme) in samples from Serum, Plasma, Cell supernatant

Human TNF α converting enzyme,TACE ELISA Kit

CN-03416H1 96T
EUR 463

Human TNF α converting enzyme,TACE ELISA Kit

CN-03416H2 48T
EUR 312

Human TNF α converting enzyme, TACE ELISA Kit

CSB-E09315h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human TNF α converting enzyme, TACE in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human TNF α converting enzyme, TACE ELISA Kit

1-CSB-E09315h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human TNF α converting enzyme, TACE in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human TNF α converting enzyme(TACE)ELISA Kit

GA-E0865HM-48T 48T
EUR 289

Human TNF α converting enzyme(TACE)ELISA Kit

GA-E0865HM-96T 96T
EUR 466

Human TNF α converting enzyme(TACE)ELISA Kit

QY-E00180 96T
EUR 361

Purified, recombinant Human TACE control protein for WB

TACE11-C 100 ul
EUR 286

ELISA kit for Human TNF Alpha converting enzyme (TACE)

KTE60912-48T 48T
EUR 381
  • TNF ? converting enzyme (TACE) encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a varie
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNF Alpha converting enzyme (TACE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TNF Alpha converting enzyme (TACE)

KTE60912-5platesof96wells 5 plates of 96 wells
EUR 2662
  • TNF ? converting enzyme (TACE) encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a varie
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNF Alpha converting enzyme (TACE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TNF Alpha converting enzyme (TACE)

KTE60912-96T 96T
EUR 669
  • TNF ? converting enzyme (TACE) encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a varie
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNF Alpha converting enzyme (TACE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rabbit Anti-Rat TNF-alpha Converting Enzyme (TACE) antiserum

TACE11-S 100 ul
EUR 457

Rabbit Anti-Rat TNF-alpha Converting Enzyme (TACE), IgG aff. Pure

TACE11-A 100 ug
EUR 482

Mouse Monoclonal Anti-Human TACE (EC domain) proteTAin IgG, aff pure

TACE12-M 100 ug
EUR 482

Human Connecting Peptide (C-Peptide) Peptide

abx670072-05mg 0.5 mg
EUR 565
  • Shipped within 1 week.

TKD Peptide (Hsp70 Peptide) (Hsp70 Peptide)

SIH-118A 1 mg
EUR 312
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide) is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.

Rat Connecting Peptide (C-Peptide) Peptide (OVA)

20-abx651058
  • EUR 425.00
  • EUR 230.00
  • EUR 1149.00
  • EUR 495.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKD Peptide (Hsp70 Peptide): FITC (Hsp70 Peptide)

SIH-119A 1 mg
EUR 359
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide): FITC is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.

C-Peptide Blocking Peptide

3277BP-50
EUR 153

TKD Peptide (Hsp70 Peptide)

abx076809-1mg 1 mg
EUR 495
  • Shipped within 5-12 working days.

Connecting Peptide (C-Peptide) Antibody

abx022864-01ml 0.1 ml
EUR 578
  • Shipped within 5-10 working days.

Connecting Peptide (C-peptide) Antibody

abx023812-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx021134-100ug 100 ug
EUR 481
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx021135-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

20-abx100155
  • EUR 258.00
  • EUR 133.00
  • EUR 606.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKD Peptide (Hsp70 Peptide) (FITC)

abx076810-1mg 1 mg
EUR 565
  • Shipped within 5-12 working days.

Human Peptide YY (PYY) Peptide

20-abx068451
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Peptide YY (PYY) Peptide

20-abx068452
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Peptide YY (PYY) Peptide

20-abx068453
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Connecting Peptide (C-Peptide) Antibody

abx411178-025mg 0.25 mg
EUR 565
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414631-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414632-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414633-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414789-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414790-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody (Biotin)

abx021132-100ug 100 ug
EUR 578
  • Shipped within 5-10 working days.

Cow Vasoactive Intestinal Peptide (VIP) Peptide

20-abx166274
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Atrial Natriuretic Peptide (ANP) Peptide

20-abx166288
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Glutaminyl Peptide Cyclotransferase (QPCT) Peptide

20-abx168154
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069654
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069655
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069656
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Atrial Natriuretic Peptide (ANP) Peptide

20-abx065482
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065483
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065484
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065486
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dog Brain Natriuretic Peptide (BNP) Peptide

20-abx065598
  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Brain Natriuretic Peptide (BNP) Peptide

20-abx065599
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Brain Natriuretic Peptide (BNP) Peptide

20-abx065600
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Brain Natriuretic Peptide (BNP) Peptide

20-abx065601
  • EUR 829.00
  • EUR 314.00
  • EUR 2666.00
  • EUR 996.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Brain Natriuretic Peptide (BNP) Peptide

20-abx065602
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065799
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065800
  • EUR 704.00
  • EUR 286.00
  • EUR 2151.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065801
  • EUR 746.00
  • EUR 286.00
  • EUR 2318.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Brain natriuretic peptide (BNP) Peptide

abx670010-01mg 0.1 mg
EUR 300
  • Shipped within 1 week.

Human Vasoactive Intestinal Peptide (VIP) Peptide

20-abx652275
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Osteogenic Growth Peptide (OGP) Peptide

20-abx652290
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Galanin Like Peptide (GALP) Peptide

20-abx650475
  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vasoactive Intestinal Peptide (VIP) Peptide (OVA)

20-abx651057
  • EUR 411.00
  • EUR 217.00
  • EUR 1080.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dog Peptide YY (PYY) Peptide (OVA)

20-abx651198
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Peptide YY (PYY) Peptide (OVA)

20-abx651199
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Peptide YY (PYY) Peptide (OVA)

20-abx651200
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Peptide YY (PYY) Peptide (OVA)

20-abx651201
  • EUR 356.00
  • EUR 217.00
  • EUR 982.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human C-Peptide (CP) Peptide (OVA)

20-abx651801
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Peptide YY (PYY) Peptide (OVA)

20-abx651848
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Atrial Natriuretic Peptide (ANP) Peptide

20-abx652084
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Brain Natriuretic Peptide (BNP) Peptide

20-abx652109
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00