Human FZD9 ELISA Kit

Human FZD9 ELISA Kit 

To Order Contact us: caitlyn@ucb-bioproducts.com

Human Frizzled Homolog 9 (FZD9)ELISA Kit
201-12-2367	SunredBio	96 tests	EUR 440
This Frizzled Homolog 9 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Frizzled Homolog 9(FZD9)ELISA Kit
QY-E02699	Qayee Biotechnology	96T	EUR 394

FZD9 siRNA
20-abx917374	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FZD9 siRNA
20-abx917375	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FZD9 antibody
70R-7131	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FZD9 antibody

FZD9 antibody
70R-31389	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FZD9 antibody

FZD9 antibody
70R-31459	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FZD9 antibody

FZD9 Antibody
ABD4886	Lifescience Market	100 ug	EUR 438

FZD9 Antibody
ABD4932	Lifescience Market	100 ug	EUR 438

FZD9 antibody
70R-17384	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FZD9 antibody

FZD9 antibody
70R-1552	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal FZD9 antibody

FZD9 Antibody
DF4886	Affbiotech	200ul	EUR 304
Description: FZD9 Antibody detects endogenous levels of total FZD9.

FZD9 Antibody
DF4932	Affbiotech	200ul	EUR 304
Description: FZD9 Antibody detects endogenous levels of total FZD9.

FZD9 Antibody
1-CSB-PA002582	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

FZD9 Antibody
1-CSB-PA618747	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

FZD9 Antibody
1-CSB-PA009112GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FZD9 Antibody
1-CSB-PA009112LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

FZD9 Antibody
1-CSB-PA060242	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Frizzled- 9, Fzd9 ELISA KIT
ELI-43214m	Lifescience Market	96 Tests	EUR 865

Chicken Frizzled- 9, FZD9 ELISA KIT
ELI-48409c	Lifescience Market	96 Tests	EUR 928

Human FZD9 shRNA Plasmid
20-abx955448	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FZD9 Recombinant Protein (Human)
RP012727	ABM	100 ug	Ask for price

Polyclonal FZD9 Antibody
APR11950G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 . This antibody is tested and proven to work in the following applications:

FZD9 cloning plasmid
CSB-CL009112HU-10ug	Cusabio	10ug	EUR 607
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1776 Sequence: atggccgtggcgcctctgcggggggcgctgctgctgtggcagctgctggcggcgggcggcgcggcactggagatcggccgcttcgacccggagcgcgggcgcggggctgcgccgtgccaggcggtggagatccccatgtgccgcggcatcggctacaacctgacccgcatgccca Show more
Description: A cloning plasmid for the FZD9 gene.

FZD9 Rabbit pAb
A8311-100ul	Abclonal	100 ul	EUR 308

FZD9 Rabbit pAb
A8311-200ul	Abclonal	200 ul	EUR 459

FZD9 Rabbit pAb
A8311-20ul	Abclonal	20 ul	EUR 183

FZD9 Rabbit pAb
A8311-50ul	Abclonal	50 ul	EUR 223

FZD9 Blocking Peptide
33R-8100	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FZD9 antibody, catalog no. 70R-1552

FZD9 Blocking Peptide
33R-9266	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FZD9 antibody, catalog no. 70R-7131

FZD9 Polyclonal Antibody
31503-100ul	SAB	100ul	EUR 252

FZD9 Polyclonal Antibody
31503-50ul	SAB	50ul	EUR 187

FZD9 Blocking Peptide
DF4886-BP	Affbiotech	1mg	EUR 195

FZD9 Blocking Peptide
DF4932-BP	Affbiotech	1mg	EUR 195

Anti-FZD9 antibody
STJ71552	St John's Laboratory	100 µg	EUR 359

Anti-FZD9 antibody
STJ110609	St John's Laboratory	100 µl	EUR 277
Description: Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney.

FZD9 ORF Vector (Human) (pORF)
ORF004243	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

FZD9 Polyclonal Conjugated Antibody
C31503	SAB	100ul	EUR 397

Mouse FZD9 shRNA Plasmid
20-abx970424	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FZD9 Antibody, HRP conjugated
1-CSB-PA009112LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FZD9 Antibody, FITC conjugated
1-CSB-PA009112LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FZD9 Antibody, Biotin conjugated
1-CSB-PA009112LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FZD9 Recombinant Protein (Rat)
RP201980	ABM	100 ug	Ask for price

FZD9 Recombinant Protein (Mouse)
RP135572	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Frizzled Homolog 9 (FZD9) Protein
20-abx653472	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

FZD9 sgRNA CRISPR Lentivector set (Human)
K0826101	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Polyclonal FZD9 Antibody (C-Term)
APR11951G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FZD9 (C-Term). This antibody is tested and proven to work in the following applications:

Frizzled Homolog 9 (FZD9) Antibody
20-abx116837	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx006123	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
abx027979-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
abx027979-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx015248	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx015286	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx326286	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx326872	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx328040	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
20-abx318138	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody
abx432721-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Fzd9 ORF Vector (Rat) (pORF)
ORF067328	ABM	1.0 ug DNA	EUR 506

Fzd9 ORF Vector (Mouse) (pORF)
ORF045192	ABM	1.0 ug DNA	EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

FZD9 sgRNA CRISPR Lentivector (Human) (Target 1)
K0826102	ABM	1.0 ug DNA	EUR 154

FZD9 sgRNA CRISPR Lentivector (Human) (Target 2)
K0826103	ABM	1.0 ug DNA	EUR 154

FZD9 sgRNA CRISPR Lentivector (Human) (Target 3)
K0826104	ABM	1.0 ug DNA	EUR 154

FZD9 Protein Vector (Human) (pPB-C-His)
PV016969	ABM	500 ng	EUR 329

FZD9 Protein Vector (Human) (pPB-N-His)
PV016970	ABM	500 ng	EUR 329

FZD9 Protein Vector (Human) (pPM-C-HA)
PV016971	ABM	500 ng	EUR 329

FZD9 Protein Vector (Human) (pPM-C-His)
PV016972	ABM	500 ng	EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Frizzled Homolog 9 (FZD9) Antibody (HRP)
20-abx315254	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody (FITC)
20-abx315255	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody (Biotin)
20-abx315256	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fzd9 sgRNA CRISPR Lentivector set (Mouse)
K3871501	ABM	3 x 1.0 ug	EUR 339

Fzd9 sgRNA CRISPR Lentivector set (Rat)
K7581801	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Polyclonal FZD9 / Frizzled 9 Antibody (aa542-591)
APG03300G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (aa542-591). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (Extracellular Domain)
APG03301G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)
APR11946G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)
APR11947G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)
APR11948G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)
APR11949G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Fzd9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3871502	ABM	1.0 ug DNA	EUR 154

Fzd9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3871503	ABM	1.0 ug DNA	EUR 154

Fzd9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3871504	ABM	1.0 ug DNA	EUR 154

Fzd9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7581802	ABM	1.0 ug DNA	EUR 154

Fzd9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7581803	ABM	1.0 ug DNA	EUR 154

Fzd9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7581804	ABM	1.0 ug DNA	EUR 154

FZD9 Protein Vector (Rat) (pPB-C-His)
PV269310	ABM	500 ng	EUR 603

FZD9 Protein Vector (Rat) (pPB-N-His)
PV269311	ABM	500 ng	EUR 603

FZD9 Protein Vector (Rat) (pPM-C-HA)
PV269312	ABM	500 ng	EUR 603

FZD9 Protein Vector (Rat) (pPM-C-His)
PV269313	ABM	500 ng	EUR 603

FZD9 Protein Vector (Mouse) (pPB-C-His)
PV180766	ABM	500 ng	EUR 603

FZD9 Protein Vector (Mouse) (pPB-N-His)
PV180767	ABM	500 ng	EUR 603

FZD9 Protein Vector (Mouse) (pPM-C-HA)
PV180768	ABM	500 ng	EUR 603

FZD9 Protein Vector (Mouse) (pPM-C-His)
PV180769	ABM	500 ng	EUR 603

Fzd9 3'UTR Luciferase Stable Cell Line
TU204863	ABM	1.0 ml	Ask for price

Fzd9 3'UTR GFP Stable Cell Line
TU156817	ABM	1.0 ml	Ask for price

FZD9 3'UTR Luciferase Stable Cell Line
TU008430	ABM	1.0 ml	EUR 1394

Fzd9 3'UTR Luciferase Stable Cell Line
TU106817	ABM	1.0 ml	Ask for price

FZD9 3'UTR GFP Stable Cell Line
TU058430	ABM	1.0 ml	EUR 1394

Fzd9 3'UTR GFP Stable Cell Line
TU254863	ABM	1.0 ml	Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0826105	ABM	3 x 1.0 ug	EUR 376

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV648787	ABM	1.0 ug DNA	EUR 682

FZD9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV648791	ABM	1.0 ug DNA	EUR 682

FZD9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV648792	ABM	1.0 ug DNA	EUR 682

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0826106	ABM	1.0 ug DNA	EUR 167

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0826107	ABM	1.0 ug DNA	EUR 167

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0826108	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3871505	ABM	3 x 1.0 ug	EUR 376

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7581805	ABM	3 x 1.0 ug	EUR 376

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3871506	ABM	1.0 ug DNA	EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3871507	ABM	1.0 ug DNA	EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3871508	ABM	1.0 ug DNA	EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7581806	ABM	1.0 ug DNA	EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7581807	ABM	1.0 ug DNA	EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7581808	ABM	1.0 ug DNA	EUR 167

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV648788	ABM	1.0 ug DNA	EUR 682

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV648789	ABM	1.0 ug DNA	EUR 740

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV648790	ABM	1.0 ug DNA	EUR 740

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human FZD9 ELISA Kit