Human FZD9 ELISA Kit

Human FZD9 ELISA Kit 

To Order Contact us: caitlyn@ucb-bioproducts.com

Human Frizzled Homolog 9 (FZD9) ELISA Kit

abx259577-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Frizzled Homolog 9(FZD9)ELISA Kit

QY-E02699 96T
EUR 394

FZD9 antibody

70R-17384 50 ul
EUR 435
Description: Rabbit polyclonal FZD9 antibody

FZD9 antibody

70R-31389 100 ug
EUR 327
Description: Rabbit polyclonal FZD9 antibody

FZD9 antibody

70R-31459 100 ug
EUR 327
Description: Rabbit polyclonal FZD9 antibody

FZD9 antibody

70R-1552 100 ug
EUR 377
Description: Rabbit polyclonal FZD9 antibody

FZD9 Antibody

1-CSB-PA002582
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

FZD9 Antibody

1-CSB-PA060242
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

FZD9 Antibody

1-CSB-PA618747
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

FZD9 Antibody

DF4886 200ul
EUR 304
Description: FZD9 Antibody detects endogenous levels of total FZD9.

FZD9 Antibody

DF4932 200ul
EUR 304
Description: FZD9 Antibody detects endogenous levels of total FZD9.

FZD9 antibody

70R-7131 50 ug
EUR 467
Description: Rabbit polyclonal FZD9 antibody

FZD9 Antibody

1-CSB-PA009112GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FZD9 Antibody

1-CSB-PA009112LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

FZD9 siRNA

20-abx917374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FZD9 siRNA

20-abx917375
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FZD9 Antibody

ABD4886 100 ug
EUR 438

FZD9 Antibody

ABD4932 100 ug
EUR 438

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse Frizzled- 9, Fzd9 ELISA KIT

ELI-43214m 96 Tests
EUR 865

Chicken Frizzled- 9, FZD9 ELISA KIT

ELI-48409c 96 Tests
EUR 928

Human FZD9 shRNA Plasmid

20-abx955448
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FZD9 Recombinant Protein (Human)

RP012727 100 ug Ask for price

FZD9 Polyclonal Antibody

31503-100ul 100ul
EUR 252

FZD9 Polyclonal Antibody

31503-50ul 50ul
EUR 187

FZD9 Blocking Peptide

33R-8100 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FZD9 antibody, catalog no. 70R-1552

FZD9 Blocking Peptide

33R-9266 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FZD9 antibody, catalog no. 70R-7131

FZD9 Blocking Peptide

DF4886-BP 1mg
EUR 195

FZD9 Blocking Peptide

DF4932-BP 1mg
EUR 195

Polyclonal FZD9 Antibody

APR11950G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 . This antibody is tested and proven to work in the following applications:

FZD9 cloning plasmid

CSB-CL009112HU-10ug 10ug
EUR 607
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atggccgtggcgcctctgcggggggcgctgctgctgtggcagctgctggcggcgggcggcgcggcactggagatcggccgcttcgacccggagcgcgggcgcggggctgcgccgtgccaggcggtggagatccccatgtgccgcggcatcggctacaacctgacccgcatgccca
  • Show more
Description: A cloning plasmid for the FZD9 gene.

FZD9 Rabbit pAb

A8311-100ul 100 ul
EUR 308

FZD9 Rabbit pAb

A8311-200ul 200 ul
EUR 459

FZD9 Rabbit pAb

A8311-20ul 20 ul
EUR 183

FZD9 Rabbit pAb

A8311-50ul 50 ul
EUR 223

Anti-FZD9 antibody

STJ110609 100 µl
EUR 277
Description: Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney.

Anti-FZD9 antibody

STJ71552 100 µg
EUR 359

FZD9 ORF Vector (Human) (pORF)

ORF004243 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

FZD9 Polyclonal Conjugated Antibody

C31503 100ul
EUR 397

FZD9 Antibody, HRP conjugated

1-CSB-PA009112LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FZD9 Antibody, FITC conjugated

1-CSB-PA009112LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FZD9 Antibody, Biotin conjugated

1-CSB-PA009112LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FZD9. Recognizes FZD9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse FZD9 shRNA Plasmid

20-abx970424
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FZD9 Recombinant Protein (Rat)

RP201980 100 ug Ask for price

FZD9 Recombinant Protein (Mouse)

RP135572 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Frizzled Homolog 9 (FZD9) Protein

20-abx653472
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

FZD9 sgRNA CRISPR Lentivector set (Human)

K0826101 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Frizzled Homolog 9 (FZD9) Antibody

20-abx006123
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

abx027979-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

abx027979-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

20-abx015248
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

20-abx015286
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

20-abx116837
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal FZD9 Antibody (C-Term)

APR11951G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FZD9 (C-Term). This antibody is tested and proven to work in the following applications:

Frizzled Homolog 9 (FZD9) Antibody

20-abx326286
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

20-abx326872
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

20-abx328040
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

20-abx318138
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody

abx432721-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fzd9 ORF Vector (Rat) (pORF)

ORF067328 1.0 ug DNA
EUR 506

Fzd9 ORF Vector (Mouse) (pORF)

ORF045192 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

FZD9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0826102 1.0 ug DNA
EUR 154

FZD9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0826103 1.0 ug DNA
EUR 154

FZD9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0826104 1.0 ug DNA
EUR 154

FZD9 Protein Vector (Human) (pPB-C-His)

PV016969 500 ng
EUR 329

FZD9 Protein Vector (Human) (pPB-N-His)

PV016970 500 ng
EUR 329

FZD9 Protein Vector (Human) (pPM-C-HA)

PV016971 500 ng
EUR 329

FZD9 Protein Vector (Human) (pPM-C-His)

PV016972 500 ng
EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Frizzled Homolog 9 (FZD9) Antibody (HRP)

20-abx315254
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody (FITC)

20-abx315255
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frizzled Homolog 9 (FZD9) Antibody (Biotin)

20-abx315256
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fzd9 sgRNA CRISPR Lentivector set (Rat)

K7581801 3 x 1.0 ug
EUR 339

Fzd9 sgRNA CRISPR Lentivector set (Mouse)

K3871501 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Polyclonal FZD9 / Frizzled 9 Antibody (aa542-591)

APG03300G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (aa542-591). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (Extracellular Domain)

APG03301G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)

APR11946G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)

APR11947G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)

APR11948G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal FZD9 / Frizzled 9 Antibody (N-Terminus)

APR11949G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FZD9 / Frizzled 9 (N-Terminus). This antibody is tested and proven to work in the following applications:

Fzd9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7581802 1.0 ug DNA
EUR 154

Fzd9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7581803 1.0 ug DNA
EUR 154

Fzd9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7581804 1.0 ug DNA
EUR 154

Fzd9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3871502 1.0 ug DNA
EUR 154

Fzd9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3871503 1.0 ug DNA
EUR 154

Fzd9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3871504 1.0 ug DNA
EUR 154

FZD9 Protein Vector (Rat) (pPB-C-His)

PV269310 500 ng
EUR 603

FZD9 Protein Vector (Rat) (pPB-N-His)

PV269311 500 ng
EUR 603

FZD9 Protein Vector (Rat) (pPM-C-HA)

PV269312 500 ng
EUR 603

FZD9 Protein Vector (Rat) (pPM-C-His)

PV269313 500 ng
EUR 603

FZD9 Protein Vector (Mouse) (pPB-C-His)

PV180766 500 ng
EUR 603

FZD9 Protein Vector (Mouse) (pPB-N-His)

PV180767 500 ng
EUR 603

FZD9 Protein Vector (Mouse) (pPM-C-HA)

PV180768 500 ng
EUR 603

FZD9 Protein Vector (Mouse) (pPM-C-His)

PV180769 500 ng
EUR 603

Fzd9 3'UTR GFP Stable Cell Line

TU156817 1.0 ml Ask for price

Fzd9 3'UTR Luciferase Stable Cell Line

TU106817 1.0 ml Ask for price

Fzd9 3'UTR Luciferase Stable Cell Line

TU204863 1.0 ml Ask for price

Fzd9 3'UTR GFP Stable Cell Line

TU254863 1.0 ml Ask for price

FZD9 3'UTR GFP Stable Cell Line

TU058430 1.0 ml
EUR 1394

FZD9 3'UTR Luciferase Stable Cell Line

TU008430 1.0 ml
EUR 1394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0826105 3 x 1.0 ug
EUR 376

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV648787 1.0 ug DNA
EUR 682

FZD9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV648791 1.0 ug DNA
EUR 682

FZD9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV648792 1.0 ug DNA
EUR 682

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0826106 1.0 ug DNA
EUR 167

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0826107 1.0 ug DNA
EUR 167

FZD9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0826108 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7581805 3 x 1.0 ug
EUR 376

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3871505 3 x 1.0 ug
EUR 376

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV648788 1.0 ug DNA
EUR 682

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV648789 1.0 ug DNA
EUR 740

FZD9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV648790 1.0 ug DNA
EUR 740

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7581806 1.0 ug DNA
EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7581807 1.0 ug DNA
EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7581808 1.0 ug DNA
EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3871506 1.0 ug DNA
EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3871507 1.0 ug DNA
EUR 167

Fzd9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3871508 1.0 ug DNA
EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human FZD9 ELISA Kit