HMGB1 detection kit

HMGB1 detection kit 

To Order Contact us: caitlyn@ucb-bioproducts.com

Human HMGB1 ELISA Kit
EHH0016 96Tests
EUR 521

Goat HMGB1 ELISA Kit
EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit
EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit
ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit
ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit
EAH0016 96Tests
EUR 521

HMGB1 ELISA KIT|Human
EF000598 96 Tests
EUR 689

Porcine HMGB1 ELISA Kit
EPH0016 96Tests
EUR 521

Rat HMGB1 ELISA Kit
ERH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit
ERTH0016 96Tests
EUR 521

Sheep HMGB1 ELISA Kit
ESH0016 96Tests
EUR 521

Mouse HMGB1 ELISA Kit
EMH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit
EMKH0016 96Tests
EUR 521

Rat HMGB1 ELISA Kit
STJ150371 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids

Human HMGB1 ELISA Kit
STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids

Mouse HMGB1 ELISA Kit
STJ150484 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Mouse serum, plasma and other biological fluids

HMGB1 Antibody
AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Protein
20-abx600027
  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.

HMGB1 siRNA
20-abx902481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody
ABF7020 100 ug
EUR 438

HMGB1 Protein
20-abx260452
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HMGB1 siRNA
20-abx919601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 siRNA
20-abx919602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Bovine HMGB1
9050 1 mg/ml x 0.1 ml
EUR 309.55
Description: Bovine HMGB1

HMGB1 Antibody
A1005-50
EUR 452

HMGB1 antibody
70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody
ABD3077 100 ug
EUR 438

HMGB1 Antibody
ABD7008 100 ug
EUR 438

HMGB1 antibody
38424-100ul 100ul
EUR 252

HMGB1 Antibody
33661-100ul 100ul
EUR 252

HMGB1 Antibody
33661-50ul 50ul
EUR 187

HMGB1 Antibody
48606-100ul 100ul
EUR 333

HMGB1 Antibody
48606-50ul 50ul
EUR 239

HMGB1 antibody
10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 protein
30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody
70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody
70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody
DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody
1-CSB-PA995991
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody
DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody
1-CSB-PA005927
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody
1-CSB-PA002937
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody
1-CSB-PA010553GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody
1-CSB-PA010553YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Antibody
1-CSB-PA225274
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HMGB1 Antibody
CSB-PA049959-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody
CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody
1-CSB-PA01604A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Plasmid
PVT7114 2 ug
EUR 266

pENTR223- HMGB1
PVT10093 2 ug
EUR 266

anti-HMGB1
YF-PA12378 100 ul
EUR 403
Description: Rabbit polyclonal to HMGB1

anti-HMGB1
YF-PA23886 50 ul
EUR 334
Description: Mouse polyclonal to HMGB1

HMGB1, human
RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Apoptosis Detection Kit
ANXVKB-100T 100 test
EUR 464.7

Apoptosis Detection Kit
ANXVKCFB-100T 100 test
EUR 412.7

Apoptosis Detection Kit
ANXVKCFB7-100T 100 test
EUR 412.7

Apoptosis Detection Kit
ANXVKDY-100T 100 test
EUR 389.3

Apoptosis Detection Kit
ANXVKF-100T 100 test
EUR 329.5

Apoptosis Detection Kit
ANXVKF7-100T 100 test
EUR 329.5

Apoptosis Detection Kit
ANXVKPE-100T 100 test
EUR 346.4

Formaldehyde Detection Kit
K001-F1 2x96 well plate
EUR 425

Autophagy Detection Kit
abx299014-50tests 50 tests
EUR 523
  • Shipped within 1 week.

Autophagy Detection Kit
abx299015-200tests 200 tests
EUR 871
  • Shipped within 1 week.

Senescence Detection Kit
55R-1370 250 tests
EUR 712
Description: Senescence Detection Kit for use in the research laboratory

SEB Detection Kit
6030 1 kit
EUR 553.15
Description: SEB Detection Kit

Senescence Detection Kit
K2030-250 250 Staining
EUR 460

Senescence Detection Kit
K320-250
EUR 468

Ubiquitin Detection Kit
SKT-131-20 20 assays
EUR 495
  • The covalent attachment of ubiquitin to proteins (ubiquitination) plays a fundamental role in the regulation of cellular function through biological events including cell cycle, differentiation, immune responses, DNA repair, chromatin structure, tran
  • Show more
Description: Purification Detection kit used to capture, detect, identify and characterise ubiquitinated proteins and free chains from samples. in Cell Lysates, Tissue samples from all species

Glutathione Detection Kit
SKT-202-96 1 plate of 96 wells
EUR 428
  • Glutathione (L-?-glutamyl-L-cysteinylglycine
  • GSH) is the highest concentration non-protein thiol in mammalian cells and is present in concentrations of 0.5 - 10 mM (1). GSH plays a key role in many biological processes, including the synthesis of pr
  • Show more
Description: Direct Fluorometric detection assay to measure the total GSH content in Whole Blood, Serum, EDTA Plasma, Heparin Plasma, Erythrocytes, Urine, Cell Lysates, Tissue samples from all species

GenomeCoV19 Detection Kit
G628.v2 100 Rxns
EUR 320
Description: The most affordable qPCR Detection Kit for SARS-CoV-2 on the market.abm’s GenomeCoV19 Detection Kit is a real-time reverse transcription-polymerase chain reaction (RT-qPCR) test intended for the qualitative detection of RNA from SARS-CoV-2 in human nasopharyngeal and oropharyngeal swab specimens from individuals suspected of COVID-19 by their healthcare provider. Our GenomeCoV19 Detection Kit is the most affordable qPCR detection kit on the market at only $1.77 USD/test (limited time pricing for US customers only).This kit is widely used in Europe under the CE-IVD certification and is listed by U.S. Food and Drug Administration (FDA) for distribution in the USA, under Section IV.C.

Guinea Pig HMGB1 ELISA Kit
EGH0016 96Tests
EUR 521

[One Step] HMGB1 antibody Kit
RK05718 50 ul
EUR 240

HMGB1 ELISA Kit (Rat) (OKAN06040)
OKAN06040 96 Wells
EUR 792
Description: Description of target: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06342)
OKAN06342 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06343)
OKAN06343 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL

HMGB1 ELISA Kit (Mouse) (OKAN06405)
OKAN06405 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL

HMGB1 ELISA Kit (Mouse) (OKCD04072)
OKCD04072 96 Wells
EUR 779
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL

HMGB1 ELISA Kit (Rat) (OKCD04073)
OKCD04073 96 Wells
EUR 818
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

HMGB1 ELISA Kit (Human) (OKCD04074)
OKCD04074 96 Wells
EUR 753
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Chicken) (OKEH03961)
OKEH03961 96 Wells
EUR 844
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. Nuclear functions are attributed to fully reduced HGMB1. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA, DNA-containing cruciforms or bent structures, supercoiled DNA and ZDNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters. Can restructure the canonical nucleosome. Proposed to be an universal biosensor for nucleic acids. May promote inflammatory response to sterile and infectious signals and may be involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm may function as sensor and/or chaperone for immunogenic nucleic acids, and mediate autophagy. May act as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

HMGB1 ELISA Kit (Dog) (OKCA02054)
OKCA02054 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

HMGB1 ELISA Kit (Pig) (OKEH07385)
OKEH07385 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059ng/mL

HMGB1 ELISA Kit (Rabbit) (OKWB00408)
OKWB00408 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Rabbit;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

HMGB1 Blocking Peptide
AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody
C48606 100ul
EUR 397

HMGB1 Conjugated Antibody
C33661 100ul
EUR 397

HMGB1 cloning plasmid
CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid
CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1/HMG-1
E21-357 10ug
EUR 343

anti- HMGB1 antibody
FNab10218 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: High mobility group protein B1
  • Uniprot ID: P09429
  • Gene ID: 3146
Description: Antibody raised against HMGB1

anti- HMGB1 antibody
FNab03924 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: high-mobility group box 1
  • Uniprot ID: P09429
  • Gene ID: 3146
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HMGB1

HMGB1 (AcK12) Antibody
20-abx141151
  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide
20-abx061647
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide
20-abx061850
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-HMGB1 Antibody
A00066-1 100ug/vial
EUR 334

HMGB1 Polyclonal Antibody
A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

HMGB1 Rabbit pAb
A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb
A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb
A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb
A0718-50ul 50 ul Ask for price

HMGB1 Polyclonal Antibody
A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

HMGB1 protein (Mouse)
30R-2278 100 ug
EUR 2012
Description: Purified recombinant Mouse HMGB1 protein

HMGB1 antibody (HRP)
60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)
60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)
60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)

HMGB1 Blocking Peptide
DF7008-BP 1mg
EUR 195

HMGB1 Blocking Peptide
DF3077-BP 1mg
EUR 195

Anti-HMGB1 antibody
PAab03924 100 ug
EUR 355

Recombinant Human HMGB1
P0194 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09429
Description: Recombinant Human protein for HMGB1

pCMV-SPORT6-HMGB1
PVT18174 2 ug
EUR 231

pET28a-HMGB1 Plasmid
PVTB00031-1a 2 ug
EUR 356

pcDNA3.1(+)-HMGB1 Plasmid
PVTB50051-2a 2 ug
EUR 356

pShuttle- CMV- HMGB1
PVT10158 2 ug
EUR 301

Anti-HMGB1 Antibody
STJ501358 100 µg
EUR 476

Anti-HMGB1 antibody
STJ29816 100 µl
EUR 457
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody
STJ24037 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody
STJ24039 100 µl
EUR 413
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 (1B2)
YF-MA13482 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D10)
YF-MA13483 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D9)
YF-MA13484 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D5)
YF-MA10425 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B11)
YF-MA10426 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (2F6)
YF-MA10427 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

HMGB1 ELISA Kit (Pig | Swine) (OKCA02201)
OKCA02201 96 Wells
EUR 917
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Pig | Swine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Thiol Fluorescent Detection Kit
K005-F1 1x96 well plate
EUR 318

Glutathione Fluorescent Detection Kit
K006-F1 1x96 well plate
EUR 354

Protein A Detection Kit
abx090813-1Kit 1 Kit
EUR 1581
  • Shipped within 5-10 working days.

Luciferase Mycoplasma Detection Kit
20-abx098882
  • EUR 1233.00
  • EUR 523.00
  • EUR 648.00
  • 200rxns
  • 25 rxns
  • 50 rxns
  • Shipped within 5-10 working days.

PCR Mycoplasma Detection Kit
abx098883-100rxns 100 rxns
EUR 537
  • Shipped within 5-10 working days.

Luciferase Mycoplasma Detection Kit
20-abx298016
  • EUR 1010.00
  • EUR 300.00
  • EUR 425.00
  • 200 rxns
  • 25 rxns
  • 50 rxns
  • Shipped within 5-10 working days.

PCR Mycoplasma Detection Kit
abx298017-100rxns 100 rxns
EUR 314
  • Shipped within 5-10 working days.

Rat Albumin Detection Kit
3020 1 kit
EUR 483.55
Description: Rat Albumin Detection Kit

MitoCapture Apoptosis Detection Kit
55R-1305 25 assays
EUR 277
Description: Apoptosis Kit for detection of apoptosis in the research laboratory

PCR-Salmonella Detection Kit
K1447-96
EUR 620

PCR-STEC Detection Kit
K1452-96
EUR 784

PCR-Campylobacter Detection Kit
K1453-96
EUR 784

DNA Methylation Detection Kit
K5082100 1 kit
EUR 344

Senescence Detection Kit (Fluorometric)
K991-100
EUR 718

MitoStep + Apoptosis Detection Kit
KMAF-100T 100 test
EUR 420.5

Ubiquitin Interact Detection Kit
SKT-132-20 20 assays
EUR 464
  • The covalent attachment of ubiquitin to proteins (ubiquitination) plays a fundamental role in the regulation of cellular function through biological events including cell cycle, differentiation, immune responses, DNA repair, chromatin structure, tran
  • Show more
Description: Purification Detection kit used to capture, detect, identify and characterise isolated ubiquitin binding proteins by Western blotting or proteomic analysis in samples. in Cell Lysates, Tissue samples from all species

Urine Creatinine Detection Kit
SKT-200-192 2 plates of 96 wells
EUR 342
  • Creatinine (2-amino-1-methyl-5H-imadazol-4-one) is a metabolite of phosphocreatine (p-creatine), a molecule used as a store for high-energy phosphate that can be utilized by tissues for the production of ATP (1). Creatine either comes from the diet o
  • Show more
Description: Direct Detection kit used for quantitative measuring creatinine in Urine samples from Human, Monkey, Dog, Rat

Nitric Oxide Detection Kit
SKT-212-96 2 plates of 96 wells
EUR 342
  • Nitric oxide (NO) is a diffusible, transient, reactive molecule that has physiological effects in the picomolar-to-micromolar range. Acting through soluble guanylate cyclase activation, NO is an important physiological regulator of the cardiovascular
  • Show more
Description: Indirect Colorimetric assay used for quantitative measuring Nitrate and Nitrite present in a variety of samples in Serum, Plasma, Urine, Saliva, Water, Buffer, Cell Lysates, Tissue Culture Media samples from all species

Hydrogen Peroxide Detection Kit
SKT-216-192 2 plates of 96 wells
EUR 441
  • In biological systems incomplete reduction of O2 during respiration produces superoxide anion (O2-·), which is spontaneously or enzymatically dismutated by superoxide dismutase to H2O2. Many cells produce low levels of O2-· and H2O2 in response to
  • Show more
Description: Direct Colorimetric assay used for quantitative measuring H2O2 in a variety of samples in Urine, Buffer, Tissue Culture Media samples from all species

Creatinine Serum Detection Kit
SKT-217-192 2 plates of 96 wells
EUR 342
  • Creatinine (2-amino-1-methyl-5H-imadazol-4-one) is a metabolite of phosphocreatine (p-creatine), a molecule used as a store for high-energy phosphate that can be utilized by tissues for the production of ATP (1). Creatine either comes from the diet o
  • Show more
Description: Direct Colorimetric assay used to measure creatinine in Serum, Plasma samples from Human, Mouse, Rabbit, Rat, Sheep

Mycoplasma PCR Detection Kit
K1476-100 100 Rxns
EUR 298

Mycoplasma Detection Kit (OKSB00010)
OKSB00010 50 Tests
EUR 382
Description: Description of target: ;Species reactivity: ;Application: PCR;Assay info: ;Sensitivity:

Residual SDS Detection Kit
BSP055 100Assays
EUR 83.06
  • Product category: Molecular Biology Kits/SDS Detection

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Rat HMGB1 shRNA Plasmid
20-abx985044
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMGB1 (AcK12) Blocking Peptide
20-abx061849
  • EUR 300.00
  • EUR 495.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 recombinant monoclonal antibody
A5052 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HMGB1 for WB, IF,ELISA

Mouse HMGB1 shRNA Plasmid
20-abx970817
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HMGB1 shRNA Plasmid
20-abx952147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Acetyl-HMGB1 (K12) Antibody
1-CSB-PA000149
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-HMGB1 (K12). Recognizes Acetyl-HMGB1 (K12) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

HMGB1 detection kit

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Blog Theme