HER4 / ErbB4 recombinant protein, 0.05mg

HER4 / ErbB4 recombinant protein, 0.05mg 

To Order Contact us: caitlyn@ucb-bioproducts.com

HER4 / ErbB4 Antibody

48301-50ul 50ul
EUR 239

HER4/ErbB4 Blocking Peptide

AF4775-BP 1mg
EUR 195

HER4 / ErbB4 Conjugated Antibody

C48301 100ul
EUR 397

Human CellExp? ErbB4/HER4, human recombinant

EUR 245

Human CellExp? ErbB4/HER4, human recombinant

EUR 697

ErbB4/HER4 (His Tagged), Human Recombinant

EUR 262

Polyclonal ERBB4 / HER4 Antibody (Internal)

APR01999G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERBB4 / HER4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ERBB4 / HER4 Antibody (Internal)

APR02023G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERBB4 / HER4 (Internal). This antibody is tested and proven to work in the following applications:

Phospho-HER4/ErbB4 (Tyr984) Antibody

AF4475 200ul
EUR 376
Description: Phospho-HER4/ErbB4 (Tyr984) Antibody detects endogenous levels of HER4/ErbB4 only when phosphorylated at Tyr984.

Phospho- HER4/ErbB4 (Tyr984) Antibody

ABF3609 100 ug
EUR 438

Phospho-HER4/ErbB4 (Tyr984) Blocking Peptide

AF4475-BP 1mg
EUR 195

Anti-ErbB4/Her4 Rabbit Monoclonal Antibody

M00296-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal ErbB4/Her4 Antibody. Validated in WB and tested in Human, Mouse, Rat.

TranslationBlocker Human ErbB4/ Her4 siRNA, 10nmol

QX21-10nmol 10nmol
EUR 377

TranslationBlocker Human ErbB4/ Her4 siRNA, 2nmol

QX21-2nmol 2nmol
EUR 276

Recombinant Human Receptor Tyrosine-protein Kinase ErbB-4/ErbB4/Her4 (C-6His)

CU22-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Receptor Tyrosine-protein Kinase ErbB-4/ErbB4/Her4 (C-6His)

CU22-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Receptor Tyrosine-protein Kinase ErbB-4/ErbB4/Her4 (C-6His)

CU22-500ug 500ug
EUR 1186
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Receptor Tyrosine-protein Kinase ErbB-4/ErbB4/Her4 (C-6His)

CU22-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

HER4 Antibody

AF6445 200ul
EUR 304
Description: HER4 Antibody detects endogenous levels of total HER4.

HER4 Antibody

ABF6445 100 ug
EUR 438

HER4 antibody

70R-33623 100 ug
EUR 327
Description: Rabbit polyclonal HER4 antibody

Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit

DLR-ErbB4-Hu-48T 48T
EUR 517
  • Should the Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit

DLR-ErbB4-Hu-96T 96T
EUR 673
  • Should the Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit

RD-ErbB4-Hu-48Tests 48 Tests
EUR 521

Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit

RD-ErbB4-Hu-96Tests 96 Tests
EUR 723

Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit

RDR-ErbB4-Hu-48Tests 48 Tests
EUR 544

Human V-Erb A Erythroblastic Leukemia Viral Oncogene Homolog 4 (ErbB4) ELISA Kit

RDR-ErbB4-Hu-96Tests 96 Tests
EUR 756

HER4 Blocking Peptide

AF6445-BP 1mg
EUR 195

HER4 (pT1284) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HER4 (pY1284) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

HER4 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HER4 (pY1284) Antibody

abx011657-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

HER4 (pY1162) Antibody

abx031867-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

HER4 (pY1162) Antibody

abx031867-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

HER4 (pY1188) Antibody

abx031868-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

HER4 (pY1188) Antibody

abx031868-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

HER4 (pY1056) Antibody

abx215223-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

HER4 (pY1242) Antibody

abx215224-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

HER4 antibody (Tyr1284)

70R-33622 100 ug
EUR 327
Description: Rabbit polyclonal HER4 antibody (Tyr1284)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERBB4 Antibody

35681-100ul 100ul
EUR 252

ERBB4 Antibody

43833-100ul 100ul
EUR 252

ERBB4 antibody

20R-ER016 50 ug
EUR 656
Description: Rabbit polyclonal ERBB4 antibody

ERBB4 antibody

20R-ER017 50 ug
EUR 656
Description: Rabbit polyclonal ERBB4 antibody

ERBB4 antibody

20R-ER018 50 ug
EUR 656
Description: Rabbit polyclonal ERBB4 antibody

ERBB4 antibody

70R-17129 50 ul
EUR 435
Description: Rabbit polyclonal ERBB4 antibody

ERBB4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ERBB4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ERBB4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

ERBB4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

ERBB4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Phospho-HER4 (Tyr1056) Antibody

AF8370 200ul
EUR 376
Description: HER4 (Phospho-Tyr1056) Antibody detects endogenous levels of HER4 only when phosphorylated at Tyr1056.

Phospho-HER4 (Tyr1242) Antibody

AF8440 200ul
EUR 376
Description: HER4 (Phospho-Tyr1242) Antibody detects endogenous levels of HER4 only when phosphorylated at Tyr1242.

Phospho-HER4 (Tyr1284) Antibody

AF3445 200ul
EUR 304
Description: Phospho-HER4 (Tyr1284) Antibody detects endogenous levels of HER4 only when phosphorylated at Tyrosine 1284.

HER4 (pY1284) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Phospho- HER4 (Tyr1284) Antibody

ABF3445 100 ug
EUR 438

HER4 (Phospho- Tyr1056) Antibody

ABF8370 100 ug
EUR 438

HER4 (Phospho- Tyr1242) Antibody

ABF8440 100 ug
EUR 438

HER4 (Phospho-Tyr1284) Antibody

12046-100ul 100ul
EUR 252

HER4 (Phospho-Tyr1284) Antibody

12046-50ul 50ul
EUR 187

HER4 (Phospho-Tyr1242) Antibody

12727-100ul 100ul
EUR 252

HER4 (Phospho-Tyr1242) Antibody

12727-50ul 50ul
EUR 187

Recombinant ErbB4 Protein (Gln 26-Pro 651) [Fc]

VAng-1514Lsx-100g 100 µg
EUR 765
Description: Human ErbB4 (Her4), Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001036064.1)

Recombinant ErbB4 Protein (Gln 26-Pro 651) [Fc]

VAng-1514Lsx-1mg 1 mg
EUR 4009
Description: Human ErbB4 (Her4), Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001036064.1)

Recombinant ErbB4 Protein (Gln 26-Pro 651) [His]

VAng-1515Lsx-100g 100 µg
EUR 820
Description: Human ErbB4 (Her4), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_005226.1)

Recombinant ErbB4 Protein (Gln 26-Pro 651) [His]

VAng-1515Lsx-1mg 1 mg
EUR 4724
Description: Human ErbB4 (Her4), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_005226.1)

Recombinant Human ErbB4 Protein (aa 1-651) [His]

VAng-Cr3992-100g 100 µg
EUR 1687
Description: Recombinant Human ErbB4 Protein (Met 1-Pro 651) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 97.5 kDa. (Accession ID: NP_001036064.1)

Recombinant Human ErbB4 Protein (aa 1-651) [His]

VAng-Cr3992-50g 50 µg
EUR 1027
Description: Recombinant Human ErbB4 Protein (Met 1-Pro 651) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 97.5 kDa. (Accession ID: NP_001036064.1)

Recombinant Rat ErbB4 Protein (aa 1-651) [His]

VAng-Cr3993-100g 100 µg
EUR 1687
Description: Recombinant Rat ErbB4 Protein (Met 1-Pro 651) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 71.3 kDa. (Accession ID: AAQ77349.1)

Recombinant Rat ErbB4 Protein (aa 1-651) [His]

VAng-Cr3993-50g 50 µg
EUR 1027
Description: Recombinant Rat ErbB4 Protein (Met 1-Pro 651) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 71.3 kDa. (Accession ID: AAQ77349.1)

Recombinant Human ErbB4 Protein (aa 1-649) [Fc]

VAng-Cr3995-100g 100 µg
EUR 1687
Description: Recombinant Human ErbB4 Protein (Met1-Arg649) fused with a Fc tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 96.6 kDa. (Accession ID: NP_005226.1)

Recombinant Human ErbB4 Protein (aa 1-649) [Fc]

VAng-Cr3995-50g 50 µg
EUR 1027
Description: Recombinant Human ErbB4 Protein (Met1-Arg649) fused with a Fc tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 96.6 kDa. (Accession ID: NP_005226.1)

Recombinant Rat ErbB4 Protein (aa 1-651) [Fc]

VAng-Cr3996-100g 100 µg
EUR 1687
Description: Recombinant Rat ErbB4 Protein (Met1-Pro651) fused with a Fc tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 96.9 kDa. (Accession ID: AAQ77349.1)

Recombinant Rat ErbB4 Protein (aa 1-651) [Fc]

VAng-Cr3996-50g 50 µg
EUR 1027
Description: Recombinant Rat ErbB4 Protein (Met1-Pro651) fused with a Fc tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 96.9 kDa. (Accession ID: AAQ77349.1)

Recombinant Mouse ErbB4 Protein (aa 1-652) [His]

VAng-Cr3997-100g 100 µg
EUR 1687
Description: Recombinant Mouse ErbB4 Protein (Met1-Leu652) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 71.5 kDa. (Accession ID: Q99P91)

Recombinant Mouse ErbB4 Protein (aa 1-652) [His]

VAng-Cr3997-50g 50 µg
EUR 1027
Description: Recombinant Mouse ErbB4 Protein (Met1-Leu652) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 71.5 kDa. (Accession ID: Q99P91)

Phospho-HER4 (Tyr1056) Blocking Peptide

AF8370-BP 1mg
EUR 195

Phospho-HER4 (Tyr1242) Blocking Peptide

AF8440-BP 1mg
EUR 195

Phospho-HER4 (Tyr1284) Blocking Peptide

AF3445-BP 1mg
EUR 195

Polyclonal Phospho-HER4(Y1162) Antibody

APR05126G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-HER4(Y1162) . This antibody is tested and proven to work in the following applications:

Polyclonal Phospho-HER4(Y1188) Antibody

APR05127G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-HER4(Y1188) . This antibody is tested and proven to work in the following applications:

ERBB4 Conjugated Antibody

C43833 100ul
EUR 397

ERBB4 Conjugated Antibody

C35681 100ul
EUR 397

anti- ERBB4 antibody

FNab02829 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:1000
  • IHC: 1:50 - 1:100
  • Immunogen: v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
  • Uniprot ID: Q15303
  • Gene ID: 2066
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Cance
  • Show more
Description: Antibody raised against ERBB4

ERBB4 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ERBB4 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ERBB4 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ERBB4 (pY1284) Antibody

abx333471-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

ERBB4 Rabbit pAb

A0749-100ul 100 ul
EUR 308

ERBB4 Rabbit pAb

A0749-200ul 200 ul
EUR 459

ERBB4 Rabbit pAb

A0749-20ul 20 ul
EUR 183

ERBB4 Rabbit pAb

A0749-50ul 50 ul
EUR 223

ERBB4 Rabbit pAb

A0750-100ul 100 ul
EUR 308

ERBB4 Rabbit pAb

A0750-200ul 200 ul
EUR 459

ERBB4 Rabbit pAb

A0750-20ul 20 ul Ask for price

ERBB4 Rabbit pAb

A0750-50ul 50 ul Ask for price

ERBB4 Rabbit pAb

A6133-100ul 100 ul
EUR 308

ERBB4 Rabbit pAb

A6133-200ul 200 ul
EUR 459

ERBB4 Rabbit pAb

A6133-20ul 20 ul
EUR 183

ERBB4 Rabbit pAb

A6133-50ul 50 ul
EUR 223

Anti-ERBB4 Antibody

EUR 403

ErbB4 Rabbit mAb

A19047-100ul 100 ul
EUR 410

ErbB4 Rabbit mAb

A19047-200ul 200 ul
EUR 571

ErbB4 Rabbit mAb

A19047-20ul 20 ul
EUR 221

ErbB4 Rabbit mAb

A19047-50ul 50 ul
EUR 287

ERBB4 cloning plasmid

CSB-CL624020HU-10ug 10ug
EUR 1378
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3927
  • Sequence: atgaagccggcgacaggactttgggtctgggtgagccttctcgtggcggcggggaccgtccagcccagcgattctcagtcagtgtgtgcaggaacggagaataaactgagctctctctctgacctggaacagcagtaccgagccttgcgcaagtactatgaaaactgtgaggttg
  • Show more
Description: A cloning plasmid for the ERBB4 gene.

Anti-ERBB4 antibody

PAab02829 100 ug
EUR 386

Anti-ERBB4 Antibody

STJ501323 100 µg
EUR 476

Anti-ERBB4 antibody

STJ27886 100 µl
EUR 277
Description: This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.

Anti-ERBB4 antibody

STJ111021 100 µl
EUR 277
Description: This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.

Anti-ERBB4 antibody

STJ23560 100 µl
EUR 277
Description: This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.

Recombinant Human ErbB4 Protein (aa 1-649) [His] (Baculovirus)

VAng-Cr3994-100g 100 µg
EUR 1687
Description: Recombinant Human ErbB4 Protein (Met1-Arg649) fused with a His tag at C-terminus was expressed in Baculovirus-Insect Cells, with a molecular weight of 71.1 kDa. (Accession ID: NP_005226.1)

Recombinant Human ErbB4 Protein (aa 1-649) [His] (Baculovirus)

VAng-Cr3994-50g 50 µg
EUR 1027
Description: Recombinant Human ErbB4 Protein (Met1-Arg649) fused with a His tag at C-terminus was expressed in Baculovirus-Insect Cells, with a molecular weight of 71.1 kDa. (Accession ID: NP_005226.1)

Recombinant Human ErbB4 Protein (aa 1-649) [His] (HEK293)

VAng-Cr3998-100g 100 µg
EUR 1687
Description: Recombinant Human ErbB4 Protein (Met1-Arg649) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 71.1 kDa. (Accession ID: NP_005226.1)

Recombinant Human ErbB4 Protein (aa 1-649) [His] (HEK293)

VAng-Cr3998-50g 50 µg
EUR 1027
Description: Recombinant Human ErbB4 Protein (Met1-Arg649) fused with a His tag at C-terminus was expressed in HEK293 Cells, with a molecular weight of 71.1 kDa. (Accession ID: NP_005226.1)

Receptor Tyrosine-Protein Kinase ErbB-4 (HER4) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Receptor Tyrosine-Protein Kinase ErbB-4 (HER4) Antibody

abx025041-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Receptor Tyrosine-Protein Kinase ErbB-4 (HER4) Antibody

abx025041-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal HER4 Antibody (C-term Y1162)

APR04335G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HER4 (C-term Y1162). This antibody is tested and proven to work in the following applications:

HER4 (Phospho-Tyr1284) Polyclonal Conjugated Antibody

C12046 100ul
EUR 397

HER4 (Phospho-Tyr1242) Polyclonal Conjugated Antibody

C12727 100ul
EUR 397

Anti-ErbB (HER4) Rabbit Monoclonal Antibody

M00296 100ug/vial
EUR 397
Description: Rabbit Monoclonal ErbB (HER4) Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Rat ERBB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009427 96 Tests
EUR 689

Human ERBB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ERBB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ERBB4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ERBB4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ERBB4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERBB4. Recognizes ERBB4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-ERBB4 (Y1284) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ERBB4 (Y1284). Recognizes Phospho-ERBB4 (Y1284) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Phospho-ERBB4 (Tyr1284) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-ERBB4 (Tyr1284). Recognizes Phospho-ERBB4 (Tyr1284) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-ERBB4 (Tyr1284) Antibody

CSB-PA696402-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-ERBB4 (Tyr1284). Recognizes Phospho-ERBB4 (Tyr1284) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Anti-ERBB4 Antibody (Biotin)

STJ501326 100 µg
EUR 586

Anti-ERBB4 Antibody (FITC)

STJ501327 100 µg
EUR 586

Antibody for Human ErbB4

SPC-1139D 0.1ml
EUR 354
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is unconjugated.

Antibody for Human ErbB4

SPC-1139D-A390 0.1ml
EUR 401
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 390.

Antibody for Human ErbB4

SPC-1139D-A488 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 488.

Antibody for Human ErbB4

SPC-1139D-A565 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 565.

Antibody for Human ErbB4

SPC-1139D-A594 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 594.

Antibody for Human ErbB4

SPC-1139D-A633 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 633.

Antibody for Human ErbB4

SPC-1139D-A655 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 655.

Antibody for Human ErbB4

SPC-1139D-A680 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 680.

Antibody for Human ErbB4

SPC-1139D-A700 0.1ml
EUR 400
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to ATTO 700.

Antibody for Human ErbB4

SPC-1139D-ALP 0.1ml
EUR 394
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human ErbB4

SPC-1139D-APC 0.1ml
EUR 399
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to APC .

Antibody for Human ErbB4

SPC-1139D-APCCY7 0.1ml
EUR 471
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to APC/Cy7.

Antibody for Human ErbB4

SPC-1139D-BI 0.1ml
EUR 396
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Biotin.

Antibody for Human ErbB4

SPC-1139D-DY350 0.1ml
EUR 475
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Dylight 350.

Antibody for Human ErbB4

SPC-1139D-DY405 0.1ml
EUR 452
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Dylight 405.

Antibody for Human ErbB4

SPC-1139D-DY488 0.1ml
EUR 432
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Dylight 488.

Antibody for Human ErbB4

SPC-1139D-DY594 0.1ml
EUR 436
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Dylight 594.

Antibody for Human ErbB4

SPC-1139D-DY633 0.1ml
EUR 426
  • ErbB4 is an RTK involved in cell growth and differentiation. Ligands are neuregulins and not EGF. Donwregulation has been described in bladder cancer to correlated with oncogensis, but upregulation of ErbB4 is noted in lung cancer. Its mutation patte
  • Show more
Description: A polyclonal antibody for ErbB4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human ErbB4 (AA42-56). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This ErbB4 antibody is conjugated to Dylight 633.

HER4 / ErbB4 recombinant protein, 0.05mg