Hams F12 Medium

Hams F12 Medium 

To Order Contact us: caitlyn@ucb-bioproducts.com

Human Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Hu-96T 96T
EUR 621
  • Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.
Mouse Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Mu-48T 48T
EUR 489
  • Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.
Mouse Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Mu-96T 96T
EUR 635
  • Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.
Human Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Hu-48Tests 48 Tests
EUR 500
Human Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Hu-96Tests 96 Tests
EUR 692
Mouse Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Mu-48Tests 48 Tests
EUR 511
Mouse Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Mu-96Tests 96 Tests
EUR 709
Human Coagulation Factor XII (F12) ELISA Kit
RD-F12-Hu-48Tests 48 Tests
EUR 478
Human Coagulation Factor XII (F12) ELISA Kit
RD-F12-Hu-96Tests 96 Tests
EUR 662
Mouse Coagulation Factor XII (F12) ELISA Kit
RD-F12-Mu-48Tests 48 Tests
EUR 489
Mouse Coagulation Factor XII (F12) ELISA Kit
RD-F12-Mu-96Tests 96 Tests
EUR 677
F12/ Rat F12 ELISA Kit
ELI-02419r 96 Tests
EUR 886
F12 antibody
70R-17186 50 ul
EUR 435
Description: Rabbit polyclonal F12 antibody
F12 Antibody
32389-100ul 100ul
EUR 252
F12 Antibody
DF6558 200ul
EUR 304
Description: F12 Antibody detects endogenous levels of total F12.
F12 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
F12 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
F12 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is Unconjugated. Tested in the following application: ELISA
F12 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
F12 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
F12 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
F12 Antibody
ABD6558 100 ug
EUR 438
423 500 ml
EUR 99
SILAC - Ham's F12
425 500 ml
EUR 105
433 1L
EUR 88
F12 Blocking Peptide
DF6558-BP 1mg
EUR 195
F12 Conjugated Antibody
C32389 100ul
EUR 397
F12 cloning plasmid
CSB-CL007918HU-10ug 10ug
EUR 363
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 903
  • Sequence: atgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccggcgaagcgggagcagccgccttccctgaccaggaacggcccactgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgt
  • Show more
Description: A cloning plasmid for the F12 gene.
F12 Rabbit pAb
A1691-100ul 100 ul
EUR 308
F12 Rabbit pAb
A1691-200ul 200 ul
EUR 459
F12 Rabbit pAb
A1691-20ul 20 ul
EUR 183
F12 Rabbit pAb
A1691-50ul 50 ul
EUR 223
PVT13753 2 ug
EUR 391
Anti-F12 antibody
STJ23595 100 µl
EUR 277
Description: This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged.
15-090-CM 1L/pk
EUR 77
Description: Media Catalog; Classical Media
15-090-CV 500 mL/pk
EUR 64
Description: Media Catalog; Classical Media
Cleaved-F12 (R372) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-F12 (R372). Recognizes Cleaved-F12 (R372) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Human F12 ELISA Kit
EHF0034 96Tests
EUR 521
Human F12 ELISA Kit
ELA-E0694h 96 Tests
EUR 824
Goat F12 ELISA Kit
EGTF0034 96Tests
EUR 521
Bovine F12 ELISA Kit
EBF0034 96Tests
EUR 521
Canine F12 ELISA Kit
ECF0034 96Tests
EUR 521
Chicken F12 ELISA Kit
ECKF0034 96Tests
EUR 521
EF000373 96 Tests
EUR 689
Rat F12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse F12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CD7(B-F12) Antibody
BNUB0310-100 100uL
EUR 209
Description: Primary antibody against CD7(B-F12), Concentration: 0.2mg/mL
CD7(B-F12) Antibody
BNUB0310-500 500uL
EUR 458
Description: Primary antibody against CD7(B-F12), Concentration: 0.2mg/mL
CD7(B-F12) Antibody
BNUM0310-50 50uL
EUR 395
Description: Primary antibody against CD7(B-F12), 1mg/mL
CD7(B-F12) Antibody
BNC040310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF405S conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC040310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF405S conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC610310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF660R conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC610310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF660R conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC470310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF647 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC470310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF647 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC550310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF555 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC550310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF555 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC050310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF405M conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC050310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF405M conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC400310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF640R conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC400310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF640R conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC430310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF543 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC430310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF543 conjugate, Concentration: 0.1mg/mL
F12 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
F12 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is HRP conjugated. Tested in the following application: ELISA
F12 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
F12 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is FITC conjugated. Tested in the following application: ELISA
F12 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
F12 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is Biotin conjugated. Tested in the following application: ELISA
Cleaved-F12 (I20) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-F12 (I20). Recognizes Cleaved-F12 (I20) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
CD7(B-F12) Antibody
BNC800310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF680 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC800310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF680 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC810310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF680R conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC810310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF680R conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCP0310-250 250uL
EUR 383
Description: Primary antibody against CD7(B-F12), PerCP conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCR0310-250 250uL
EUR 383
Description: Primary antibody against CD7(B-F12), RPE conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCA0310-250 250uL
EUR 383
Description: Primary antibody against CD7(B-F12), APC conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCAP0310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCAP0310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCH0310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCH0310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC940310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF594 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC940310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF594 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC700310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF770 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC700310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF770 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCB0310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), Biotin conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNCB0310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), Biotin conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC880310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF488A conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC880310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF488A conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC680310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF568 conjugate, Concentration: 0.1mg/mL
CD7(B-F12) Antibody
BNC680310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF568 conjugate, Concentration: 0.1mg/mL
Human F12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse F12 ELISA Kit
EMF0034 96Tests
EUR 521

Hams F12 Medium