DCYTB (CYBRD1)

DCYTB (CYBRD1) 

To Order Contact us: caitlyn@ucb-bioproducts.com

CYBRD1 siRNA

20-abx913321
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CYBRD1 Antibody

1-CSB-PA006326LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

CYBRD1 cloning plasmid

CSB-CL006326HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 861
  • Sequence: atggccatggagggctactggcgcttcctggcgctgctggggtcggcactgctcgtcggcttcctgtcggtgatcttcgccctcgtctgggtcctccactaccgagaggggcttggctgggatgggagcgcactagagtttaactggcacccagtgctcatggtcaccggcttcgt
  • Show more
Description: A cloning plasmid for the CYBRD1 gene.

Mouse Duodenal cytochrome B (Dcytb) Control/blocking peptide

DCYTB11-P 100 ug
EUR 164

Rabbit Anti-Mouse Duodenal cytochrome B (Dcytb) antiserum

DCYTB11-S 100 ul
EUR 457

Mouse CYBRD1 shRNA Plasmid

20-abx977986
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CYBRD1 shRNA Plasmid

20-abx988772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CYBRD1 shRNA Plasmid

20-abx962653
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CYBRD1 ELISA KIT|Human

EF004821 96 Tests
EUR 689

CYBRD1 Antibody, HRP conjugated

1-CSB-PA006326LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CYBRD1 Antibody, FITC conjugated

1-CSB-PA006326LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CYBRD1 Antibody, Biotin conjugated

1-CSB-PA006326LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CYBRD1 Recombinant Protein (Human)

RP008560 100 ug Ask for price

CYBRD1 Recombinant Protein (Rat)

RP196991 100 ug Ask for price

CYBRD1 Recombinant Protein (Mouse)

RP126989 100 ug Ask for price

CYBRD1 ORF Vector (Human) (pORF)

ORF002854 1.0 ug DNA
EUR 95

Cybrd1 ORF Vector (Rat) (pORF)

ORF065665 1.0 ug DNA
EUR 506

Cybrd1 ORF Vector (Mouse) (pORF)

ORF042331 1.0 ug DNA
EUR 506

Rabbit Anti-Mouse Duodenal cytochrome B (Dcytb) aff pure IgG

DCYTB11-A 100 ug
EUR 482

CYBRD1 sgRNA CRISPR Lentivector set (Human)

K0543201 3 x 1.0 ug
EUR 339

Cybrd1 sgRNA CRISPR Lentivector set (Mouse)

K3441001 3 x 1.0 ug
EUR 339

Cybrd1 sgRNA CRISPR Lentivector set (Rat)

K6754001 3 x 1.0 ug
EUR 339

CYBRD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0543202 1.0 ug DNA
EUR 154

CYBRD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0543203 1.0 ug DNA
EUR 154

CYBRD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0543204 1.0 ug DNA
EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3441002 1.0 ug DNA
EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3441003 1.0 ug DNA
EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3441004 1.0 ug DNA
EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6754002 1.0 ug DNA
EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6754003 1.0 ug DNA
EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6754004 1.0 ug DNA
EUR 154

CYBRD1 Protein Vector (Human) (pPB-C-His)

PV011413 500 ng
EUR 329

CYBRD1 Protein Vector (Human) (pPB-N-His)

PV011414 500 ng
EUR 329

CYBRD1 Protein Vector (Human) (pPM-C-HA)

PV011415 500 ng
EUR 329

CYBRD1 Protein Vector (Human) (pPM-C-His)

PV011416 500 ng
EUR 329

CYBRD1 Protein Vector (Mouse) (pPB-C-His)

PV169322 500 ng
EUR 603

CYBRD1 Protein Vector (Mouse) (pPB-N-His)

PV169323 500 ng
EUR 603

CYBRD1 Protein Vector (Mouse) (pPM-C-HA)

PV169324 500 ng
EUR 603

CYBRD1 Protein Vector (Mouse) (pPM-C-His)

PV169325 500 ng
EUR 603

CYBRD1 Protein Vector (Rat) (pPB-C-His)

PV262658 500 ng
EUR 603

CYBRD1 Protein Vector (Rat) (pPB-N-His)

PV262659 500 ng
EUR 603

CYBRD1 Protein Vector (Rat) (pPM-C-HA)

PV262660 500 ng
EUR 603

CYBRD1 Protein Vector (Rat) (pPM-C-His)

PV262661 500 ng
EUR 603

Cybrd1 3'UTR Luciferase Stable Cell Line

TU203022 1.0 ml Ask for price

Cybrd1 3'UTR GFP Stable Cell Line

TU154615 1.0 ml Ask for price

CYBRD1 3'UTR Luciferase Stable Cell Line

TU005382 1.0 ml
EUR 2333

Cybrd1 3'UTR Luciferase Stable Cell Line

TU104615 1.0 ml Ask for price

CYBRD1 3'UTR GFP Stable Cell Line

TU055382 1.0 ml
EUR 2333

Cybrd1 3'UTR GFP Stable Cell Line

TU253022 1.0 ml Ask for price

Goat Cytochrome b reductase 1(CYBRD1) ELISA kit

E06C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome b reductase 1(CYBRD1) ELISA kit

E06C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome b reductase 1(CYBRD1) ELISA kit

E06C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1(CYBRD1) ELISA kit

E01C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1(CYBRD1) ELISA kit

E01C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1(CYBRD1) ELISA kit

E01C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome b reductase 1(CYBRD1) ELISA kit

E02C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome b reductase 1(CYBRD1) ELISA kit

E02C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome b reductase 1(CYBRD1) ELISA kit

E02C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome b reductase 1(CYBRD1) ELISA kit

E03C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome b reductase 1(CYBRD1) ELISA kit

E03C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome b reductase 1(CYBRD1) ELISA kit

E03C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b reductase 1(CYBRD1) ELISA kit

E04C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b reductase 1(CYBRD1) ELISA kit

E04C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b reductase 1(CYBRD1) ELISA kit

E04C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytochrome b reductase 1(CYBRD1) ELISA kit

E08C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytochrome b reductase 1(CYBRD1) ELISA kit

E08C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytochrome b reductase 1(CYBRD1) ELISA kit

E08C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome b reductase 1(CYBRD1) ELISA kit

E09C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome b reductase 1(CYBRD1) ELISA kit

E09C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome b reductase 1(CYBRD1) ELISA kit

E09C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytochrome b reductase 1(CYBRD1) ELISA kit

E07C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytochrome b reductase 1(CYBRD1) ELISA kit

E07C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytochrome b reductase 1(CYBRD1) ELISA kit

E07C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1, CYBRD1 ELISA KIT

ELI-26407h 96 Tests
EUR 824

Mouse Cytochrome b reductase 1, Cybrd1 ELISA KIT

ELI-09013m 96 Tests
EUR 865

Human Cytochrome B Reductase 1 (CYBRD1) ELISA Kit

abx384763-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Cytochrome B Reductase 1 (CYBRD1) ELISA Kit

abx388976-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV681409 1.0 ug DNA
EUR 514

CYBRD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV681413 1.0 ug DNA
EUR 514

CYBRD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV681414 1.0 ug DNA
EUR 514

Guinea pig Cytochrome b reductase 1(CYBRD1) ELISA kit

E05C2213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cytochrome b reductase 1(CYBRD1) ELISA kit

E05C2213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cytochrome b reductase 1(CYBRD1) ELISA kit

E05C2213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Cytochrome b reductase 1 (CYBRD1)

KTE71358-48T 48T
EUR 332
  • Cytochrome b reductase 1 (CYBRD1) is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytochrome b reductase 1 (CYBRD1)

KTE71358-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Cytochrome b reductase 1 (CYBRD1) is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytochrome b reductase 1 (CYBRD1)

KTE71358-96T 96T
EUR 539
  • Cytochrome b reductase 1 (CYBRD1) is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytochrome b reductase 1 (CYBRD1)

KTE100810-48T 48T
EUR 332
  • CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytochrome b reductase 1 (CYBRD1)

KTE100810-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytochrome b reductase 1 (CYBRD1)

KTE100810-96T 96T
EUR 539
  • CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytochrome b reductase 1 (CYBRD1)

KTE62181-48T 48T
EUR 332
  • CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytochrome b reductase 1 (CYBRD1)

KTE62181-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytochrome b reductase 1 (CYBRD1)

KTE62181-96T 96T
EUR 539
  • CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cybrd1 ELISA Kit| Mouse Cytochrome b reductase 1 ELISA Kit

EF014603 96 Tests
EUR 689

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0543205 3 x 1.0 ug
EUR 376

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3441005 3 x 1.0 ug
EUR 376

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6754005 3 x 1.0 ug
EUR 376

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0543206 1.0 ug DNA
EUR 167

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0543207 1.0 ug DNA
EUR 167

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0543208 1.0 ug DNA
EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3441006 1.0 ug DNA
EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3441007 1.0 ug DNA
EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3441008 1.0 ug DNA
EUR 167

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV681410 1.0 ug DNA
EUR 514

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV681411 1.0 ug DNA
EUR 572

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV681412 1.0 ug DNA
EUR 572

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6754006 1.0 ug DNA
EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6754007 1.0 ug DNA
EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6754008 1.0 ug DNA
EUR 167

DCYTB (CYBRD1)