DCYTB (CYBRD1)

DCYTB (CYBRD1) 

To Order Contact us: caitlyn@ucb-bioproducts.com

CYBRD1 siRNA
20-abx913321	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CYBRD1 Antibody
1-CSB-PA006326LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

CYBRD1 cloning plasmid
CSB-CL006326HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 861 Sequence: atggccatggagggctactggcgcttcctggcgctgctggggtcggcactgctcgtcggcttcctgtcggtgatcttcgccctcgtctgggtcctccactaccgagaggggcttggctgggatgggagcgcactagagtttaactggcacccagtgctcatggtcaccggcttcgt Show more
Description: A cloning plasmid for the CYBRD1 gene.

Mouse Duodenal cytochrome B (Dcytb) Control/blocking peptide
DCYTB11-P	Alpha Diagnostics	100 ug	EUR 164

Rabbit Anti-Mouse Duodenal cytochrome B (Dcytb) antiserum
DCYTB11-S	Alpha Diagnostics	100 ul	EUR 457

Mouse CYBRD1 shRNA Plasmid
20-abx977986	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat CYBRD1 shRNA Plasmid
20-abx988772	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CYBRD1 shRNA Plasmid
20-abx962653	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CYBRD1 ELISA KIT|Human
EF004821	Lifescience Market	96 Tests	EUR 689

CYBRD1 Antibody, HRP conjugated
1-CSB-PA006326LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CYBRD1 Antibody, FITC conjugated
1-CSB-PA006326LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CYBRD1 Antibody, Biotin conjugated
1-CSB-PA006326LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYBRD1. Recognizes CYBRD1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CYBRD1 Recombinant Protein (Human)
RP008560	ABM	100 ug	Ask for price

CYBRD1 Recombinant Protein (Rat)
RP196991	ABM	100 ug	Ask for price

CYBRD1 Recombinant Protein (Mouse)
RP126989	ABM	100 ug	Ask for price

CYBRD1 ORF Vector (Human) (pORF)
ORF002854	ABM	1.0 ug DNA	EUR 95

Cybrd1 ORF Vector (Rat) (pORF)
ORF065665	ABM	1.0 ug DNA	EUR 506

Cybrd1 ORF Vector (Mouse) (pORF)
ORF042331	ABM	1.0 ug DNA	EUR 506

Rabbit Anti-Mouse Duodenal cytochrome B (Dcytb) aff pure IgG
DCYTB11-A	Alpha Diagnostics	100 ug	EUR 482

CYBRD1 sgRNA CRISPR Lentivector set (Human)
K0543201	ABM	3 x 1.0 ug	EUR 339

Cybrd1 sgRNA CRISPR Lentivector set (Mouse)
K3441001	ABM	3 x 1.0 ug	EUR 339

Cybrd1 sgRNA CRISPR Lentivector set (Rat)
K6754001	ABM	3 x 1.0 ug	EUR 339

CYBRD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0543202	ABM	1.0 ug DNA	EUR 154

CYBRD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0543203	ABM	1.0 ug DNA	EUR 154

CYBRD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0543204	ABM	1.0 ug DNA	EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3441002	ABM	1.0 ug DNA	EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3441003	ABM	1.0 ug DNA	EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3441004	ABM	1.0 ug DNA	EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6754002	ABM	1.0 ug DNA	EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6754003	ABM	1.0 ug DNA	EUR 154

Cybrd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6754004	ABM	1.0 ug DNA	EUR 154

CYBRD1 Protein Vector (Human) (pPB-C-His)
PV011413	ABM	500 ng	EUR 329

CYBRD1 Protein Vector (Human) (pPB-N-His)
PV011414	ABM	500 ng	EUR 329

CYBRD1 Protein Vector (Human) (pPM-C-HA)
PV011415	ABM	500 ng	EUR 329

CYBRD1 Protein Vector (Human) (pPM-C-His)
PV011416	ABM	500 ng	EUR 329

CYBRD1 Protein Vector (Mouse) (pPB-C-His)
PV169322	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Mouse) (pPB-N-His)
PV169323	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Mouse) (pPM-C-HA)
PV169324	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Mouse) (pPM-C-His)
PV169325	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Rat) (pPB-C-His)
PV262658	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Rat) (pPB-N-His)
PV262659	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Rat) (pPM-C-HA)
PV262660	ABM	500 ng	EUR 603

CYBRD1 Protein Vector (Rat) (pPM-C-His)
PV262661	ABM	500 ng	EUR 603

Cybrd1 3'UTR Luciferase Stable Cell Line
TU203022	ABM	1.0 ml	Ask for price

Cybrd1 3'UTR GFP Stable Cell Line
TU154615	ABM	1.0 ml	Ask for price

CYBRD1 3'UTR Luciferase Stable Cell Line
TU005382	ABM	1.0 ml	EUR 2333

Cybrd1 3'UTR Luciferase Stable Cell Line
TU104615	ABM	1.0 ml	Ask for price

CYBRD1 3'UTR GFP Stable Cell Line
TU055382	ABM	1.0 ml	EUR 2333

Cybrd1 3'UTR GFP Stable Cell Line
TU253022	ABM	1.0 ml	Ask for price

Goat Cytochrome b reductase 1(CYBRD1) ELISA kit
E06C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome b reductase 1(CYBRD1) ELISA kit
E06C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome b reductase 1(CYBRD1) ELISA kit
E06C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1(CYBRD1) ELISA kit
E01C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1(CYBRD1) ELISA kit
E01C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1(CYBRD1) ELISA kit
E01C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome b reductase 1(CYBRD1) ELISA kit
E02C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome b reductase 1(CYBRD1) ELISA kit
E02C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome b reductase 1(CYBRD1) ELISA kit
E02C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome b reductase 1(CYBRD1) ELISA kit
E03C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome b reductase 1(CYBRD1) ELISA kit
E03C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome b reductase 1(CYBRD1) ELISA kit
E03C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b reductase 1(CYBRD1) ELISA kit
E04C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b reductase 1(CYBRD1) ELISA kit
E04C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b reductase 1(CYBRD1) ELISA kit
E04C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytochrome b reductase 1(CYBRD1) ELISA kit
E08C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytochrome b reductase 1(CYBRD1) ELISA kit
E08C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytochrome b reductase 1(CYBRD1) ELISA kit
E08C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome b reductase 1(CYBRD1) ELISA kit
E09C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome b reductase 1(CYBRD1) ELISA kit
E09C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome b reductase 1(CYBRD1) ELISA kit
E09C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytochrome b reductase 1(CYBRD1) ELISA kit
E07C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytochrome b reductase 1(CYBRD1) ELISA kit
E07C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytochrome b reductase 1(CYBRD1) ELISA kit
E07C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome b reductase 1, CYBRD1 ELISA KIT
ELI-26407h	Lifescience Market	96 Tests	EUR 824

Mouse Cytochrome b reductase 1, Cybrd1 ELISA KIT
ELI-09013m	Lifescience Market	96 Tests	EUR 865

Human Cytochrome B Reductase 1 (CYBRD1) ELISA Kit
abx384763-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Cytochrome B Reductase 1 (CYBRD1) ELISA Kit
abx388976-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV681409	ABM	1.0 ug DNA	EUR 514

CYBRD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV681413	ABM	1.0 ug DNA	EUR 514

CYBRD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV681414	ABM	1.0 ug DNA	EUR 514

Guinea pig Cytochrome b reductase 1(CYBRD1) ELISA kit
E05C2213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cytochrome b reductase 1(CYBRD1) ELISA kit
E05C2213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cytochrome b reductase 1(CYBRD1) ELISA kit
E05C2213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cytochrome b reductase 1(CYBRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Cytochrome b reductase 1 (CYBRD1)
KTE71358-48T	Abbkine	48T	EUR 332
Cytochrome b reductase 1 (CYBRD1) is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytochrome b reductase 1 (CYBRD1)
KTE71358-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Cytochrome b reductase 1 (CYBRD1) is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytochrome b reductase 1 (CYBRD1)
KTE71358-96T	Abbkine	96T	EUR 539
Cytochrome b reductase 1 (CYBRD1) is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytochrome b reductase 1 (CYBRD1)
KTE100810-48T	Abbkine	48T	EUR 332
CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytochrome b reductase 1 (CYBRD1)
KTE100810-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytochrome b reductase 1 (CYBRD1)
KTE100810-96T	Abbkine	96T	EUR 539
CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytochrome b reductase 1 (CYBRD1)
KTE62181-48T	Abbkine	48T	EUR 332
CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp Show more
Description: Quantitative sandwich ELISA for measuring Human Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytochrome b reductase 1 (CYBRD1)
KTE62181-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp Show more
Description: Quantitative sandwich ELISA for measuring Human Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytochrome b reductase 1 (CYBRD1)
KTE62181-96T	Abbkine	96T	EUR 539
CYBRD1 is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorp Show more
Description: Quantitative sandwich ELISA for measuring Human Cytochrome b reductase 1 (CYBRD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cybrd1 ELISA Kit| Mouse Cytochrome b reductase 1 ELISA Kit
EF014603	Lifescience Market	96 Tests	EUR 689

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0543205	ABM	3 x 1.0 ug	EUR 376

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3441005	ABM	3 x 1.0 ug	EUR 376

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6754005	ABM	3 x 1.0 ug	EUR 376

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0543206	ABM	1.0 ug DNA	EUR 167

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0543207	ABM	1.0 ug DNA	EUR 167

CYBRD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0543208	ABM	1.0 ug DNA	EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3441006	ABM	1.0 ug DNA	EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3441007	ABM	1.0 ug DNA	EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3441008	ABM	1.0 ug DNA	EUR 167

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV681410	ABM	1.0 ug DNA	EUR 514

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV681411	ABM	1.0 ug DNA	EUR 572

CYBRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV681412	ABM	1.0 ug DNA	EUR 572

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6754006	ABM	1.0 ug DNA	EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6754007	ABM	1.0 ug DNA	EUR 167

Cybrd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6754008	ABM	1.0 ug DNA	EUR 167

DCYTB (CYBRD1)