Anti-rbm45

Anti-rbm45 

To Order Contact us: caitlyn@ucb-bioproducts.com

RBM45 siRNA

20-abx904501
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBM45 siRNA

20-abx931077
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBM45 siRNA

20-abx931078
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBM45 Polyclonal Antibody

28377-100ul 100ul
EUR 252

RBM45 Polyclonal Antibody

28377-50ul 50ul
EUR 187

RBM45 Rabbit pAb

A13843-100ul 100 ul
EUR 308

RBM45 Rabbit pAb

A13843-200ul 200 ul
EUR 459

RBM45 Rabbit pAb

A13843-20ul 20 ul
EUR 183

RBM45 Rabbit pAb

A13843-50ul 50 ul
EUR 223

RBM45 Blocking Peptide

33R-6375 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBM45 antibody, catalog no. 70R-4727

RBM45 cloning plasmid

CSB-CL814203HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1425
  • Sequence: atggacgaagctggcagctctgcgagcggcgggggcttccgcccgggcgtggacagcctggacgaaccgcccaacagccgcatcttccttgtgatcagcaagtacacacctgagtcggtgctgagggagcgcttctcgccttttggcgacatccaggacatctgggtggtgcggg
  • Show more
Description: A cloning plasmid for the RBM45 gene.

RBM45 Polyclonal Antibody

A69047 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

RBM45 Antibody, HRP conjugated

1-CSB-PA814203LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM45. Recognizes RBM45 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBM45 Antibody, FITC conjugated

1-CSB-PA814203LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM45. Recognizes RBM45 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBM45 Antibody, Biotin conjugated

1-CSB-PA814203LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM45. Recognizes RBM45 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RBM45 shRNA Plasmid

20-abx988081
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RBM45 shRNA Plasmid

20-abx965011
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RBM45 Polyclonal Conjugated Antibody

C28377 100ul
EUR 397

Mouse RBM45 shRNA Plasmid

20-abx982519
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RBM45 Recombinant Protein (Human)

RP025969 100 ug Ask for price

RBM45 Recombinant Protein (Mouse)

RP167210 100 ug Ask for price

RBM45 Recombinant Protein (Rat)

RP223853 100 ug Ask for price

Polyclonal RBM45 Antibody (C-term)

APR04092G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RBM45 (C-term). This antibody is tested and proven to work in the following applications:

RBM45 Polyclonal Antibody, HRP Conjugated

A69048 100 ?g
EUR 628.55
Description: fast delivery possible

RBM45 Polyclonal Antibody, FITC Conjugated

A69049 100 ?g
EUR 628.55
Description: reagents widely cited

RBM45 Polyclonal Antibody, Biotin Conjugated

A69050 100 ?g
EUR 628.55
Description: Ask the seller for details

Rbm45 ORF Vector (Rat) (pORF)

ORF074619 1.0 ug DNA
EUR 506

RBM45 ORF Vector (Human) (pORF)

ORF008657 1.0 ug DNA
EUR 95

Rbm45 ORF Vector (Mouse) (pORF)

ORF055738 1.0 ug DNA
EUR 506

Rbm45 sgRNA CRISPR Lentivector set (Rat)

K6295401 3 x 1.0 ug
EUR 339

RBM45 sgRNA CRISPR Lentivector set (Human)

K1796001 3 x 1.0 ug
EUR 339

Rbm45 sgRNA CRISPR Lentivector set (Mouse)

K3581801 3 x 1.0 ug
EUR 339

RNA Binding Motif Protein 45 (RBM45) Antibody

abx122038-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 45 (RBM45) Antibody

abx028722-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 45 (RBM45) Antibody

abx028722-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 45 (RBM45) Antibody

20-abx338669
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rbm45 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6295402 1.0 ug DNA
EUR 154

Rbm45 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6295403 1.0 ug DNA
EUR 154

Rbm45 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6295404 1.0 ug DNA
EUR 154

RBM45 sgRNA CRISPR Lentivector (Human) (Target 1)

K1796002 1.0 ug DNA
EUR 154

RBM45 sgRNA CRISPR Lentivector (Human) (Target 2)

K1796003 1.0 ug DNA
EUR 154

RBM45 sgRNA CRISPR Lentivector (Human) (Target 3)

K1796004 1.0 ug DNA
EUR 154

Rbm45 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3581802 1.0 ug DNA
EUR 154

Rbm45 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3581803 1.0 ug DNA
EUR 154

Rbm45 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3581804 1.0 ug DNA
EUR 154

RBM45 Protein Vector (Rat) (pPB-C-His)

PV298474 500 ng
EUR 603

RBM45 Protein Vector (Rat) (pPB-N-His)

PV298475 500 ng
EUR 603

RBM45 Protein Vector (Rat) (pPM-C-HA)

PV298476 500 ng
EUR 603

RBM45 Protein Vector (Rat) (pPM-C-His)

PV298477 500 ng
EUR 603

RBM45 Protein Vector (Human) (pPB-C-His)

PV034625 500 ng
EUR 329

RBM45 Protein Vector (Human) (pPB-N-His)

PV034626 500 ng
EUR 329

RBM45 Protein Vector (Human) (pPM-C-HA)

PV034627 500 ng
EUR 329

RBM45 Protein Vector (Human) (pPM-C-His)

PV034628 500 ng
EUR 329

RBM45 Protein Vector (Mouse) (pPB-C-His)

PV222950 500 ng
EUR 603

RBM45 Protein Vector (Mouse) (pPB-N-His)

PV222951 500 ng
EUR 603

RBM45 Protein Vector (Mouse) (pPM-C-HA)

PV222952 500 ng
EUR 603

RBM45 Protein Vector (Mouse) (pPM-C-His)

PV222953 500 ng
EUR 603

Rbm45 3'UTR Luciferase Stable Cell Line

TU117631 1.0 ml Ask for price

Rbm45 3'UTR GFP Stable Cell Line

TU167631 1.0 ml Ask for price

Rbm45 3'UTR Luciferase Stable Cell Line

TU217393 1.0 ml Ask for price

Rbm45 3'UTR GFP Stable Cell Line

TU267393 1.0 ml Ask for price

RBM45 3'UTR GFP Stable Cell Line

TU069616 1.0 ml
EUR 1394

RBM45 3'UTR Luciferase Stable Cell Line

TU019616 1.0 ml
EUR 1394

Human RNA- binding protein 45, RBM45 ELISA KIT

ELI-30104h 96 Tests
EUR 824

Mouse RNA- binding protein 45, Rbm45 ELISA KIT

ELI-30105m 96 Tests
EUR 865

RNA Binding Motif Protein 45 (RBM45) Antibody (HRP)

20-abx337540
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 45 (RBM45) Antibody (FITC)

20-abx337541
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 45 (RBM45) Antibody (Biotin)

20-abx337542
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RBM45 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667261 1.0 ug DNA
EUR 682

RBM45 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667265 1.0 ug DNA
EUR 682

RBM45 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667266 1.0 ug DNA
EUR 682

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6295405 3 x 1.0 ug
EUR 376

RBM45 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1796005 3 x 1.0 ug
EUR 376

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3581805 3 x 1.0 ug
EUR 376

RBM45 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV667262 1.0 ug DNA
EUR 682

RBM45 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV667263 1.0 ug DNA
EUR 740

RBM45 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV667264 1.0 ug DNA
EUR 740

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6295406 1.0 ug DNA
EUR 167

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6295407 1.0 ug DNA
EUR 167

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6295408 1.0 ug DNA
EUR 167

RBM45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1796006 1.0 ug DNA
EUR 167

RBM45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1796007 1.0 ug DNA
EUR 167

RBM45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1796008 1.0 ug DNA
EUR 167

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3581806 1.0 ug DNA
EUR 167

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3581807 1.0 ug DNA
EUR 167

Rbm45 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3581808 1.0 ug DNA
EUR 167

anti-Anti-WDTC1

YF-PA17718 50 ug
EUR 363
Description: Mouse polyclonal to Anti-WDTC1

anti-Anti-THUMPD3

YF-PA18133 50 ul
EUR 363
Description: Mouse polyclonal to Anti-THUMPD3

anti-Anti-IL19

YF-PA18651 100 ug
EUR 403
Description: Rabbit polyclonal to Anti-IL19

anti-Anti-LIME

YF-PA19446 50 ul
EUR 363
Description: Mouse polyclonal to Anti-LIME

anti-Anti-SYNJ2BP

YF-PA19694 50 ug
EUR 363
Description: Mouse polyclonal to Anti-SYNJ2BP

anti-Anti-CSGALNACT2

YF-PA19724 100 ug
EUR 403
Description: Rabbit polyclonal to Anti-CSGALNACT2

anti-Anti-TEX2

YF-PA19889 50 ug
EUR 363
Description: Mouse polyclonal to Anti-TEX2

anti-Anti-MGC2803

YF-PA20705 50 ul
EUR 363
Description: Mouse polyclonal to Anti-MGC2803

anti-Anti-MGC2803

YF-PA20706 50 ug
EUR 363
Description: Mouse polyclonal to Anti-MGC2803

anti-Anti-RECK

YF-PA15627 50 ul
EUR 363
Description: Mouse polyclonal to Anti-RECK

anti-Anti-RECK

YF-PA15628 50 ug
EUR 363
Description: Mouse polyclonal to Anti-RECK

anti-Anti-RECK

YF-PA15629 100 ug
EUR 403
Description: Rabbit polyclonal to Anti-RECK

anti-Anti-RAI3

YF-PA16054 50 ul
EUR 363
Description: Mouse polyclonal to Anti-RAI3

anti-Anti-RAI3

YF-PA16055 50 ug
EUR 363
Description: Mouse polyclonal to Anti-RAI3

anti-Anti-PHC3

YF-PA20991 50 ul
EUR 363
Description: Mouse polyclonal to Anti-PHC3

anti-Anti-ZNF670

YF-PA21783 50 ul
EUR 363
Description: Mouse polyclonal to Anti-ZNF670

anti-Anti-MGC16943

YF-PA21814 50 ug
EUR 363
Description: Mouse polyclonal to Anti-MGC16943

anti-Anti-SAT2

YF-PA21815 50 ug
EUR 363
Description: Mouse polyclonal to Anti-SAT2

anti-Anti-STK11IP

YF-PA21878 50 ul
EUR 363
Description: Mouse polyclonal to Anti-STK11IP

anti-Anti-LY108

YF-PA21890 50 ug
EUR 363
Description: Mouse polyclonal to Anti-LY108

anti-Anti-MDH1B

YF-PA22189 50 ug
EUR 363
Description: Mouse polyclonal to Anti-MDH1B

anti-Anti-ZDHHC19

YF-PA22203 50 ul
EUR 363
Description: Mouse polyclonal to Anti-ZDHHC19

anti-Anti-UGT3A1

YF-PA22231 50 ug
EUR 363
Description: Mouse polyclonal to Anti-UGT3A1

anti-Anti-RALYL

YF-PA22261 50 ug
EUR 363
Description: Mouse polyclonal to Anti-RALYL

anti-Anti-BTBD14A

YF-PA22262 50 ul
EUR 363
Description: Mouse polyclonal to Anti-BTBD14A

anti-Anti-KLC3

YF-PA22405 50 ul
EUR 363
Description: Mouse polyclonal to Anti-KLC3

anti-Anti-UPP2

YF-PA22477 50 ug
EUR 363
Description: Mouse polyclonal to Anti-UPP2

anti-Anti-SCFD2

YF-PA22491 50 ug
EUR 363
Description: Mouse polyclonal to Anti-SCFD2

anti-Anti-DNAJB8

YF-PA22588 50 ug
EUR 363
Description: Mouse polyclonal to Anti-DNAJB8

anti-Anti-ZUFSP

YF-PA22749 50 ul
EUR 363
Description: Mouse polyclonal to Anti-ZUFSP

anti-Anti-NUDT8

YF-PA22826 50 ul
EUR 363
Description: Mouse polyclonal to Anti-NUDT8

anti-Anti-NUDT8

YF-PA22827 50 ug
EUR 363
Description: Mouse polyclonal to Anti-NUDT8

anti-Anti-SYBL1

YF-PA24797 50 ul
EUR 334
Description: Mouse polyclonal to Anti-SYBL1

anti-Anti-TAF2

YF-PA24803 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TAF2

anti-Anti-TM4SF2

YF-PA24859 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TM4SF2

anti-Anti-TRPC6

YF-PA24902 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TRPC6

anti-Anti-Tubby

YF-PA24913 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Tubby

anti-Anti-UBA52

YF-PA24923 50 ul
EUR 334
Description: Mouse polyclonal to Anti-UBA52

anti-Anti-EID1

YF-PA25927 50 ul
EUR 334
Description: Mouse polyclonal to Anti-EID1

anti-Anti-IL19

YF-PA26093 50 ul
EUR 334
Description: Mouse polyclonal to Anti-IL19

anti-Anti-RPL26L1

YF-PA26137 50 ul
EUR 334
Description: Mouse polyclonal to Anti-RPL26L1

anti-Anti-DUSP13

YF-PA26151 50 ul
EUR 334
Description: Mouse polyclonal to Anti-DUSP13

anti-Anti-Zfp219

YF-PA26153 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Zfp219

anti-Anti-RNF21

YF-PA26234 50 ul
EUR 334
Description: Mouse polyclonal to Anti-RNF21

anti-Anti-EPN3

YF-PA26300 50 ul
EUR 334
Description: Mouse polyclonal to Anti-EPN3

anti-Anti-ZNF446

YF-PA26352 50 ul
EUR 334
Description: Mouse polyclonal to Anti-ZNF446

anti-Anti-EXOC1

YF-PA26361 50 ul
EUR 334
Description: Mouse polyclonal to Anti-EXOC1

anti-Anti-NCLN

YF-PA26440 50 ul
EUR 334
Description: Mouse polyclonal to Anti-NCLN

anti-Anti-CHMP1B

YF-PA26462 50 ul
EUR 334
Description: Mouse polyclonal to Anti-CHMP1B

anti-Anti-BIRC6

YF-PA26472 50 ul
EUR 334
Description: Mouse polyclonal to Anti-BIRC6

anti-Anti-AHRR

YF-PA26478 50 ul
EUR 334
Description: Mouse polyclonal to Anti-AHRR

anti-Anti-ATPAF1

YF-PA26568 50 ul
EUR 334
Description: Mouse polyclonal to Anti-ATPAF1

anti-Anti-DCAF10

YF-PA26603 50 ul
EUR 334
Description: Mouse polyclonal to Anti-DCAF10

anti-Anti-FYCO1

YF-PA26607 50 ul
EUR 334
Description: Mouse polyclonal to Anti-FYCO1

anti-Anti-COL21A1

YF-PA26663 50 ul
EUR 334
Description: Mouse polyclonal to Anti-COL21A1

anti-Anti-IGSF21

YF-PA26758 50 ul
EUR 334
Description: Mouse polyclonal to Anti-IGSF21

anti-Anti-RFT1

YF-PA26782 50 ul
EUR 334
Description: Mouse polyclonal to Anti-RFT1

anti-Anti-TIMM50

YF-PA26786 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TIMM50

anti-Anti-COX6B2

YF-PA26857 50 ul
EUR 334
Description: Mouse polyclonal to Anti-COX6B2

anti-Anti-TRA16

YF-PA26859 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TRA16

anti-Anti-EMID2

YF-PA26883 50 ul
EUR 334
Description: Mouse polyclonal to Anti-EMID2

anti-Anti-GATA5

YF-PA26897 50 ul
EUR 334
Description: Mouse polyclonal to Anti-GATA5

anti-Anti-Lgi4

YF-PA26939 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Lgi4

anti-Anti-SNX31

YF-PA26947 50 ul
EUR 334
Description: Mouse polyclonal to Anti-SNX31

anti-Anti-ADAMTS15

YF-PA26950 50 ul
EUR 334
Description: Mouse polyclonal to Anti-ADAMTS15

anti-Anti-APOBEC3F

YF-PA26963 50 ul
EUR 334
Description: Mouse polyclonal to Anti-APOBEC3F

anti-Anti-Lgi3

YF-PA26969 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Lgi3

anti-Anti-LASS3

YF-PA26971 50 ul
EUR 334
Description: Mouse polyclonal to Anti-LASS3

anti-Anti-RNF214

YF-PA27009 50 ul
EUR 334
Description: Mouse polyclonal to Anti-RNF214

anti-Anti-TMIE

YF-PA27013 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TMIE

anti-Anti-CATSPER3

YF-PA27044 50 ul
EUR 334
Description: Mouse polyclonal to Anti-CATSPER3

anti-Anti-DNAJB13

YF-PA27047 50 ul
EUR 334
Description: Mouse polyclonal to Anti-DNAJB13

anti-Anti-Cdc14B

YF-PA25130 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Cdc14B

anti-Anti-SUCLG1

YF-PA25189 50 ul
EUR 334
Description: Mouse polyclonal to Anti-SUCLG1

anti-Anti-NPIP

YF-PA25300 50 ul
EUR 334
Description: Mouse polyclonal to Anti-NPIP

anti-Anti-PTER

YF-PA25306 50 ul
EUR 334
Description: Mouse polyclonal to Anti-PTER

anti-Anti-SEP15

YF-PA25331 50 ul
EUR 334
Description: Mouse polyclonal to Anti-SEP15

anti-Anti-PERK

YF-PA25342 50 ul
EUR 334
Description: Mouse polyclonal to Anti-PERK

anti-Anti-Rab3D

YF-PA25362 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Rab3D

anti-Anti-MAML1

YF-PA25409 50 ul
EUR 334
Description: Mouse polyclonal to Anti-MAML1

anti-Anti-SLC12A6

YF-PA25449 50 ul
EUR 334
Description: Mouse polyclonal to Anti-SLC12A6

anti-Anti-PREB

YF-PA25488 50 ul
EUR 334
Description: Mouse polyclonal to Anti-PREB

anti-Anti-ADAMTS7

YF-PA25755 50 ul
EUR 334
Description: Mouse polyclonal to Anti-ADAMTS7

anti-Anti-GABARAPL2

YF-PA25795 50 ul
EUR 334
Description: Mouse polyclonal to Anti-GABARAPL2

anti-Anti-Palladin

YF-PA25831 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Palladin

anti-Anti-LARG

YF-PA25871 50 ul
EUR 334
Description: Mouse polyclonal to Anti-LARG

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

anti-Anti-Prokineticin 2

YF-PA26534 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Prokineticin 2

anti-Anti-Frizzled 6

YF-PA25073 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Frizzled 6

anti-Anti-eIF2B epsilon

YF-PA25227 50 ul
EUR 334
Description: Mouse polyclonal to Anti-eIF2B epsilon

anti-Anti-Semaphorin 5A

YF-PA25252 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Semaphorin 5A

anti-Anti-Transglutaminase 5

YF-PA25312 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Transglutaminase 5

anti-Anti-Serine Palmitoyltransferase

YF-PA25355 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Serine Palmitoyltransferase

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-rbm45