Anti-MYO1F Antibody

Anti-MYO1F Antibody 

To Order Contact us: caitlyn@ucb-bioproducts.com

MYO1F Antibody
44670-100ul 100ul
EUR 252

MYO1F Antibody
44670-50ul 50ul
EUR 187

MYO1F Antibody
DF2210 200ul
EUR 304
Description: MYO1F antibody detects endogenous levels of total MYO1F.

MYO1F Antibody
ABD2210 100 ug
EUR 438

MYO1F Conjugated Antibody
C44670 100ul
EUR 397

MYO1F Polyclonal Antibody
ABP59376-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody
ABP59376-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody
ABP59376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody
ES9851-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F Polyclonal Antibody
ES9851-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F siRNA
20-abx925215
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody
20-abx217018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody
20-abx177687
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody
20-abx100606
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody
abx036673-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody
20-abx130219
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MYO1F Blocking Peptide
DF2210-BP 1mg
EUR 195

MYO1F cloning plasmid
CSB-CL015343HU-10ug 10ug
EUR 1209
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3297
  • Sequence: atgggcagcaaggagcgcttccactggcagagccacaacgtgaagcagagcggcgtggatgacatggtgcttcttccccagatcaccgaagacgccattgccgccaacctccggaagcgcttcatggacgactacatcttcacctacatcggctctgtgctcatctctgtaaacc
  • Show more
Description: A cloning plasmid for the MYO1F gene.

Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280

Human MYO1F shRNA Plasmid
20-abx953012
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Myosin IF (MYO1F)
4-RPD435Hu01
  • EUR 479.90
  • EUR 232.00
  • EUR 1524.64
  • EUR 574.88
  • EUR 1049.76
  • EUR 384.00
  • EUR 3661.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00160
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Myosin IF expressed in: E.coli

Recombinant Myosin IF (MYO1F)
4-RPD435Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A7X9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 9.9
Description: Recombinant Rat Myosin IF expressed in: E.coli

Myosin IF (MYO1F) Polyclonal Antibody (Human)
4-PAD435Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Rat)
4-PAD435Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC
4-PAD435Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Biotinylated
4-PAD435Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Cy3
4-PAD435Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Human), FITC
4-PAD435Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), HRP
4-PAD435Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Human), PE
4-PAD435Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC
4-PAD435Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Biotinylated
4-PAD435Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Cy3
4-PAD435Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), FITC
4-PAD435Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), HRP
4-PAD435Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), PE
4-PAD435Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with PE.

Rat Myosin IF (MYO1F) Protein
20-abx167674
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Myosin IF (MYO1F) Protein
20-abx068162
  • EUR 676.00
  • EUR 272.00
  • EUR 2054.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myo1f ORF Vector (Rat) (pORF)
ORF071012 1.0 ug DNA
EUR 506

MYO1F ORF Vector (Human) (pORF)
ORF006850 1.0 ug DNA
EUR 95

Myo1f ORF Vector (Mouse) (pORF)
ORF050903 1.0 ug DNA
EUR 506

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC-Cy7
4-PAD435Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC-Cy7
4-PAD435Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Mouse Myosin- If, Myo1f ELISA KIT
ELI-12963m 96 Tests
EUR 865

Human Myosin- If, MYO1F ELISA KIT
ELI-19967h 96 Tests
EUR 824

Myo1f sgRNA CRISPR Lentivector set (Mouse)
K4811701 3 x 1.0 ug
EUR 339

Myo1f sgRNA CRISPR Lentivector set (Rat)
K6447101 3 x 1.0 ug
EUR 339

MYO1F sgRNA CRISPR Lentivector set (Human)
K1378401 3 x 1.0 ug
EUR 339

Human Myosin IF(MYO1F)ELISA Kit
QY-E03045 96T
EUR 361

ELISA kit for Human Myosin-If (MYO1F)
KTE61421-48T 48T
EUR 332
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-If (MYO1F)
KTE61421-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-If (MYO1F)
KTE61421-96T 96T
EUR 539
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4811702 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4811703 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4811704 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 1)
K6447102 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 2)
K6447103 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 3)
K6447104 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 1)
K1378402 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 2)
K1378403 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 3)
K1378404 1.0 ug DNA
EUR 154

ELISA kit for Mouse Myosin-If (MYO1F)
KTE70871-48T 48T
EUR 332
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)
KTE70871-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)
KTE70871-96T 96T
EUR 539
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MYO1F Protein Vector (Mouse) (pPB-C-His)
PV203610 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPB-N-His)
PV203611 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPM-C-HA)
PV203612 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPM-C-His)
PV203613 500 ng
EUR 1065

MYO1F Protein Vector (Rat) (pPB-C-His)
PV284046 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPB-N-His)
PV284047 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPM-C-HA)
PV284048 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPM-C-His)
PV284049 500 ng
EUR 1166

MYO1F Protein Vector (Human) (pPB-C-His)
PV027397 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPB-N-His)
PV027398 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPM-C-HA)
PV027399 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPM-C-His)
PV027400 500 ng
EUR 329

Myo1f 3'UTR Luciferase Stable Cell Line
TU113739 1.0 ml Ask for price

Myo1f 3'UTR GFP Stable Cell Line
TU163739 1.0 ml Ask for price

Myo1f 3'UTR Luciferase Stable Cell Line
TU213659 1.0 ml Ask for price

Myo1f 3'UTR GFP Stable Cell Line
TU263659 1.0 ml Ask for price

MYO1F 3'UTR GFP Stable Cell Line
TU065082 1.0 ml
EUR 1394

MYO1F 3'UTR Luciferase Stable Cell Line
TU015082 1.0 ml
EUR 1394

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4811705 3 x 1.0 ug
EUR 376

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6447105 3 x 1.0 ug
EUR 376

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1378405 3 x 1.0 ug
EUR 376

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4811706 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4811707 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4811708 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6447106 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6447107 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6447108 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1378406 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1378407 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1378408 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-MYO1F Antibody

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Blog Theme