Anti-MYO1F Antibody

Anti-MYO1F Antibody 

To Order Contact us: caitlyn@ucb-bioproducts.com

MYO1F Antibody

ABD2210 100 ug
EUR 438

MYO1F Antibody

44670-100ul 100ul
EUR 252

MYO1F Antibody

44670-50ul 50ul
EUR 187

MYO1F Antibody

DF2210 200ul
EUR 304
Description: MYO1F antibody detects endogenous levels of total MYO1F.

MYO1F Conjugated Antibody

C44670 100ul
EUR 397

MYO1F Polyclonal Antibody

ES9851-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F Polyclonal Antibody

ES9851-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F Polyclonal Antibody

ABP59376-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody

ABP59376-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody

ABP59376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F siRNA

20-abx925215
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx130219
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

abx036673-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx100606
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

20-abx177687
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

20-abx217018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MYO1F cloning plasmid

CSB-CL015343HU-10ug 10ug
EUR 1209
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3297
  • Sequence: atgggcagcaaggagcgcttccactggcagagccacaacgtgaagcagagcggcgtggatgacatggtgcttcttccccagatcaccgaagacgccattgccgccaacctccggaagcgcttcatggacgactacatcttcacctacatcggctctgtgctcatctctgtaaacc
  • Show more
Description: A cloning plasmid for the MYO1F gene.

MYO1F Blocking Peptide

DF2210-BP 1mg
EUR 195

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Human MYO1F shRNA Plasmid

20-abx953012
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Myosin IF (MYO1F)

4-RPD435Hu01
  • EUR 479.90
  • EUR 232.00
  • EUR 1524.64
  • EUR 574.88
  • EUR 1049.76
  • EUR 384.00
  • EUR 3661.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00160
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Myosin IF expressed in: E.coli

Recombinant Myosin IF (MYO1F)

4-RPD435Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A7X9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 9.9
Description: Recombinant Rat Myosin IF expressed in: E.coli

Myosin IF (MYO1F) Polyclonal Antibody (Human)

4-PAD435Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Rat)

4-PAD435Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC

4-PAD435Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Biotinylated

4-PAD435Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Cy3

4-PAD435Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Human), FITC

4-PAD435Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), HRP

4-PAD435Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Human), PE

4-PAD435Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC

4-PAD435Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Biotinylated

4-PAD435Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Cy3

4-PAD435Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), FITC

4-PAD435Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), HRP

4-PAD435Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), PE

4-PAD435Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with PE.

Human Myosin IF (MYO1F) Protein

20-abx068162
  • EUR 676.00
  • EUR 272.00
  • EUR 2054.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Myosin IF (MYO1F) Protein

20-abx167674
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MYO1F ORF Vector (Human) (pORF)

ORF006850 1.0 ug DNA
EUR 95

Myo1f ORF Vector (Mouse) (pORF)

ORF050903 1.0 ug DNA
EUR 506

Myo1f ORF Vector (Rat) (pORF)

ORF071012 1.0 ug DNA
EUR 506

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC-Cy7

4-PAD435Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC-Cy7

4-PAD435Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Mouse Myosin- If, Myo1f ELISA KIT

ELI-12963m 96 Tests
EUR 865

Human Myosin- If, MYO1F ELISA KIT

ELI-19967h 96 Tests
EUR 824

MYO1F sgRNA CRISPR Lentivector set (Human)

K1378401 3 x 1.0 ug
EUR 339

Myo1f sgRNA CRISPR Lentivector set (Rat)

K6447101 3 x 1.0 ug
EUR 339

Myo1f sgRNA CRISPR Lentivector set (Mouse)

K4811701 3 x 1.0 ug
EUR 339

Human Myosin IF(MYO1F)ELISA Kit

QY-E03045 96T
EUR 361

MYO1F sgRNA CRISPR Lentivector (Human) (Target 1)

K1378402 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 2)

K1378403 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 3)

K1378404 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 1)

K6447102 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 2)

K6447103 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 3)

K6447104 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4811702 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4811703 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4811704 1.0 ug DNA
EUR 154

ELISA kit for Human Myosin-If (MYO1F)

KTE61421-48T 48T
EUR 332
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-If (MYO1F)

KTE61421-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-If (MYO1F)

KTE61421-96T 96T
EUR 539
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)

KTE70871-48T 48T
EUR 332
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)

KTE70871-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)

KTE70871-96T 96T
EUR 539
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MYO1F Protein Vector (Rat) (pPB-C-His)

PV284046 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPB-N-His)

PV284047 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPM-C-HA)

PV284048 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPM-C-His)

PV284049 500 ng
EUR 1166

MYO1F Protein Vector (Human) (pPB-C-His)

PV027397 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPB-N-His)

PV027398 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPM-C-HA)

PV027399 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPM-C-His)

PV027400 500 ng
EUR 329

MYO1F Protein Vector (Mouse) (pPB-C-His)

PV203610 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPB-N-His)

PV203611 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPM-C-HA)

PV203612 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPM-C-His)

PV203613 500 ng
EUR 1065

Myo1f 3'UTR GFP Stable Cell Line

TU163739 1.0 ml Ask for price

Myo1f 3'UTR Luciferase Stable Cell Line

TU213659 1.0 ml Ask for price

MYO1F 3'UTR Luciferase Stable Cell Line

TU015082 1.0 ml
EUR 1394

Myo1f 3'UTR Luciferase Stable Cell Line

TU113739 1.0 ml Ask for price

MYO1F 3'UTR GFP Stable Cell Line

TU065082 1.0 ml
EUR 1394

Myo1f 3'UTR GFP Stable Cell Line

TU263659 1.0 ml Ask for price

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1378405 3 x 1.0 ug
EUR 376

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6447105 3 x 1.0 ug
EUR 376

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4811705 3 x 1.0 ug
EUR 376

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1378406 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1378407 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1378408 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6447106 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6447107 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6447108 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4811706 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4811707 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4811708 1.0 ug DNA
EUR 167

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody

E61I006 1mg
EUR 349

anti- ASH2L antibody

FNab00637 100µg
EUR 505.25
  • Immunogen: ash2(absent, small, or homeotic)-like(Drosophila)
  • Uniprot ID: Q9UBL3
  • Gene ID: 9070
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody

FNab00638 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 1, neuronal
  • Uniprot ID: Q16515
  • Gene ID: 40
  • Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody

FNab00639 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 4, pituitary
  • Uniprot ID: Q96FT7
  • Gene ID: 55515
  • Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody

FNab00640 100µg
EUR 505.25
  • Recommended dilution: WB: 1:100-1:1000
  • Immunogen: mitogen-activated protein kinase kinase kinase 5
  • Uniprot ID: Q99683
  • Gene ID: 4217
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody

FNab00641 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:500
  • Immunogen: argininosuccinate lyase
  • Uniprot ID: P04424
  • Gene ID: 435
  • Research Area: Metabolism
Description: Antibody raised against ASL

anti- ASMTL antibody

FNab00642 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • Immunogen: acetylserotonin O-methyltransferase-like
  • Uniprot ID: O95671
  • Gene ID: 8623
  • Research Area: Metabolism
Description: Antibody raised against ASMTL

anti- ASNA1 antibody

FNab00643 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
  • Uniprot ID: O43681
  • Gene ID: 439
  • Research Area: Metabolism
Description: Antibody raised against ASNA1

anti- ASNS antibody

FNab00644 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: asparagine synthetase
  • Uniprot ID: P08243
  • Gene ID: 440
  • Research Area: Metabolism
Description: Antibody raised against ASNS

anti- ASPA antibody

FNab00645 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartoacylase(Canavan disease)
  • Uniprot ID: P45381
  • Gene ID: 443
  • Research Area: Metabolism
Description: Antibody raised against ASPA

anti- ASPH antibody

FNab00646 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartate beta-hydroxylase
  • Uniprot ID: Q12797
  • Gene ID: 444
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ASPH

anti- ASPRV1 antibody

FNab00647 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: aspartic peptidase, retroviral-like 1
  • Uniprot ID: Q53RT3
  • Gene ID: 151516
  • Research Area: Metabolism
Description: Antibody raised against ASPRV1

anti- ASRGL1 antibody

FNab00648 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: asparaginase like 1
  • Uniprot ID: Q7L266
  • Gene ID: 80150
  • Research Area: Metabolism
Description: Antibody raised against ASRGL1

anti- ASS1 antibody

FNab00649 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:6000
  • IP: 1:500-1:3000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASS1 antibody

FNab00650 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:100-1:500
  • IF: 1:20-1:100
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASTL antibody

FNab00651 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: astacin-like metallo-endopeptidase(M12 family)
  • Uniprot ID: Q6HA08
  • Gene ID: 431705
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against ASTL

anti- ASTN2 antibody

FNab00652 100µg
EUR 505.25
  • Immunogen: astrotactin 2
  • Uniprot ID: O75129
  • Gene ID: 23245
  • Research Area: Metabolism
Description: Antibody raised against ASTN2

anti- ASZ1 antibody

FNab00653 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ankyrin repeat, SAM and basic leucine zipper domain containing 1
  • Uniprot ID: Q8WWH4
  • Gene ID: 136991
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against ASZ1

anti- ATAD1 antibody

FNab00654 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • Immunogen: ATPase family, AAA domain containing 1
  • Uniprot ID: Q8NBU5
  • Gene ID: 84896
  • Research Area: Metabolism
Description: Antibody raised against ATAD1

anti- ATAD2 antibody

FNab00655 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 2
  • Uniprot ID: Q6PL18
  • Gene ID: 29028
  • Research Area: Metabolism
Description: Antibody raised against ATAD2

anti- ATAD5 antibody

FNab00656 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 5
  • Uniprot ID: Q96QE3
  • Gene ID: 79915
  • Research Area: Metabolism
Description: Antibody raised against ATAD5

anti- ATE1 antibody

FNab00658 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: arginyltransferase 1
  • Uniprot ID: O95260
  • Gene ID: 11101
  • Research Area: Metabolism
Description: Antibody raised against ATE1

anti- ATF1 antibody

FNab00659 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: activating transcription factor 1
  • Uniprot ID: P18846
  • Gene ID: 466
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ATF1

anti- ATF2 antibody

FNab00660 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: activating transcription factor 2
  • Uniprot ID: P15336
  • Gene ID: 1386
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against ATF2

anti- ATF4 antibody

FNab00662 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Meta
  • Show more
Description: Antibody raised against ATF4

anti- ATF4 antibody

FNab00663 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:2000
  • IHC: 1:50-1:300
  • IF: 1:20-1:100
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Metabolism, Developme
  • Show more
Description: Antibody raised against ATF4

anti- ATF6 antibody

FNab00664 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6
  • Uniprot ID: P18850
  • Gene ID: 22926
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6

anti- ATF6B antibody

FNab00665 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IP:1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6 beta
  • Uniprot ID: Q99941
  • Gene ID: 1388
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6B

anti- ATG12 antibody

FNab00666 100µg
EUR 548.75
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG12 antibody

FNab00667 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • IF: 1:10-1:100
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG13 antibody

FNab00668 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: KIAA0652
  • Uniprot ID: O75143
  • Gene ID: 9776
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG13

anti- ATG16L1 antibody

FNab00669 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ATG16 autophagy related 16-like 1
  • Uniprot ID: Q676U5
  • Gene ID: 55054
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L1

anti- ATG16L2 antibody

FNab00670 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IF: 1:50-1:500
  • Immunogen: ATG16 autophagy related 16-like 2(S. cerevisiae)
  • Uniprot ID: Q8NAA4
  • Gene ID: 89849
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L2

anti- ATG2A antibody

FNab00671 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ATG2 autophagy related 2 homolog A
  • Uniprot ID: Q2TAZ0
  • Gene ID: 23130
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2A

anti- ATG2B antibody

FNab00672 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: ATG2 autophagy related 2 homolog B(S. cerevisiae)
  • Uniprot ID: Q96BY7
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2B

anti- ATG3 antibody

FNab00673 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATG3 autophagy related 3 homolog (S. cerevisiae)
  • Uniprot ID: Q9NT62
  • Gene ID: 64422
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against ATG3

anti- ATG4B antibody

FNab00674 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog B(S. cerevisiae)
  • Uniprot ID: Q9Y4P1
  • Gene ID: 23192
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4B

anti- ATG4C antibody

FNab00675 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog C(S. cerevisiae)
  • Uniprot ID: Q96DT6
  • Gene ID: 84938
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4C

anti- ATG4D antibody

FNab00676 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATG4 autophagy related 4 homolog D(S. cerevisiae)
  • Uniprot ID: Q86TL0
  • Gene ID: 84971
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4D

anti- ATG5 antibody

FNab00677 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ATG5 autophagy related 5 homolog
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG5 antibody

FNab00678 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:3000
  • Immunogen: ATG5 autophagy related 5 homolog(S. cerevisiae)
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG7 antibody

FNab00679 100µg
EUR 548.75
  • Immunogen: ATG7 autophagy related 7 homolog(S. cerevisiae)
  • Uniprot ID: O95352
  • Gene ID: 10533
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG7

anti- ATGL antibody

FNab00680 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: patatin-like phospholipase domain containing 2
  • Uniprot ID: Q96AD5
  • Gene ID: 57104
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATGL

anti- ATIC antibody

FNab00681 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
  • Uniprot ID: P31939
  • Gene ID: 471
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATIC

anti- ATL2 antibody

FNab00683 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atlastin GTPase 2
  • Uniprot ID: Q8NHH9
  • Gene ID: 64225
  • Research Area: Metabolism
Description: Antibody raised against ATL2

anti- ATL3 antibody

FNab00684 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IF: 1:10-1:100
  • Immunogen: atlastin GTPase 3
  • Uniprot ID: Q6DD88
  • Gene ID: 25923
  • Research Area: Metabolism
Description: Antibody raised against ATL3

anti- ATN1 antibody

FNab00685 100µg
EUR 505.25
  • Immunogen: atrophin 1
  • Uniprot ID: P54259
  • Gene ID: 1822
  • Research Area: Neuroscience
Description: Antibody raised against ATN1

anti- ATOH1 antibody

FNab00686 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atonal homolog 1
  • Uniprot ID: Q92858
  • Gene ID: 474
  • Research Area: Neuroscience
Description: Antibody raised against ATOH1

anti- ATP11B antibody

FNab00688 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20 - 1:200
  • Immunogen: ATPase, class VI, type 11B
  • Uniprot ID: Q9Y2G3
  • Gene ID: 23200
  • Research Area: Metabolism
Description: Antibody raised against ATP11B

anti- ATP12A antibody

FNab00689 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
  • Uniprot ID: P54707
  • Gene ID: 479
  • Research Area: Metabolism
Description: Antibody raised against ATP12A

anti- ATP13A1 antibody

FNab00690 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:20-1:200
  • Immunogen: ATPase type 13A1
  • Uniprot ID: Q9HD20
  • Gene ID: 57130
  • Research Area: Metabolism
Description: Antibody raised against ATP13A1

anti- ATP1A1 antibody

FNab00691 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:500
  • Immunogen: ATPase, Na+/K+ transporting, alpha 1 polypeptide
  • Uniprot ID: P05023
  • Gene ID: 476
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A1

anti- ATP1A2 antibody

FNab00693 100µg
EUR 505.25
  • Immunogen: ATPase, Na+/K+ transporting, alpha 2(+) polypeptide
  • Uniprot ID: P50993
  • Gene ID: 477
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A2

anti- ATP1A3 antibody

FNab00695 100µg
EUR 548.75
  • Immunogen: ATPase, Na+/K+ transporting, alpha 3 polypeptide
  • Uniprot ID: P13637
  • Gene ID: 478
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A3

anti- ATP1B1 antibody

FNab00696 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, Na+/K+ transporting, beta 1 polypeptide
  • Uniprot ID: P05026
  • Gene ID: 481
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1B1

Anti-MYO1F Antibody