Anti-MYO1F Antibody

Anti-MYO1F Antibody 

To Order Contact us: caitlyn@ucb-bioproducts.com

MYO1F Antibody

44670-100ul 100ul
EUR 252

MYO1F Antibody

44670-50ul 50ul
EUR 187

MYO1F Antibody

DF2210 200ul
EUR 304
Description: MYO1F antibody detects endogenous levels of total MYO1F.

MYO1F Antibody

ABD2210 100 ug
EUR 438

MYO1F Conjugated Antibody

C44670 100ul
EUR 397

MYO1F Polyclonal Antibody

ABP59376-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody

ABP59376-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody

ABP59376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Polyclonal Antibody

ES9851-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F Polyclonal Antibody

ES9851-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F siRNA

20-abx925215
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx217018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx177687
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

20-abx100606
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

abx036673-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx130219
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MYO1F Blocking Peptide

DF2210-BP 1mg
EUR 195

MYO1F cloning plasmid

CSB-CL015343HU-10ug 10ug
EUR 1209
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3297
  • Sequence: atgggcagcaaggagcgcttccactggcagagccacaacgtgaagcagagcggcgtggatgacatggtgcttcttccccagatcaccgaagacgccattgccgccaacctccggaagcgcttcatggacgactacatcttcacctacatcggctctgtgctcatctctgtaaacc
  • Show more
Description: A cloning plasmid for the MYO1F gene.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Human MYO1F shRNA Plasmid

20-abx953012
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Myosin IF (MYO1F)

4-RPD435Hu01
  • EUR 479.90
  • EUR 232.00
  • EUR 1524.64
  • EUR 574.88
  • EUR 1049.76
  • EUR 384.00
  • EUR 3661.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00160
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Myosin IF expressed in: E.coli

Recombinant Myosin IF (MYO1F)

4-RPD435Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A7X9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 9.9
Description: Recombinant Rat Myosin IF expressed in: E.coli

Myosin IF (MYO1F) Polyclonal Antibody (Human)

4-PAD435Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Rat)

4-PAD435Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC

4-PAD435Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Biotinylated

4-PAD435Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Cy3

4-PAD435Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Human), FITC

4-PAD435Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), HRP

4-PAD435Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Human), PE

4-PAD435Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC

4-PAD435Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Biotinylated

4-PAD435Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Cy3

4-PAD435Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), FITC

4-PAD435Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), HRP

4-PAD435Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), PE

4-PAD435Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with PE.

Rat Myosin IF (MYO1F) Protein

20-abx167674
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Myosin IF (MYO1F) Protein

20-abx068162
  • EUR 676.00
  • EUR 272.00
  • EUR 2054.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myo1f ORF Vector (Rat) (pORF)

ORF071012 1.0 ug DNA
EUR 506

MYO1F ORF Vector (Human) (pORF)

ORF006850 1.0 ug DNA
EUR 95

Myo1f ORF Vector (Mouse) (pORF)

ORF050903 1.0 ug DNA
EUR 506

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC-Cy7

4-PAD435Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC-Cy7

4-PAD435Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Mouse Myosin- If, Myo1f ELISA KIT

ELI-12963m 96 Tests
EUR 865

Human Myosin- If, MYO1F ELISA KIT

ELI-19967h 96 Tests
EUR 824

Myo1f sgRNA CRISPR Lentivector set (Mouse)

K4811701 3 x 1.0 ug
EUR 339

Myo1f sgRNA CRISPR Lentivector set (Rat)

K6447101 3 x 1.0 ug
EUR 339

MYO1F sgRNA CRISPR Lentivector set (Human)

K1378401 3 x 1.0 ug
EUR 339

Human Myosin IF(MYO1F)ELISA Kit

QY-E03045 96T
EUR 361

ELISA kit for Human Myosin-If (MYO1F)

KTE61421-48T 48T
EUR 332
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-If (MYO1F)

KTE61421-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-If (MYO1F)

KTE61421-96T 96T
EUR 539
  • Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. Myosin-If encoded by MYO1F is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. Th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4811702 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4811703 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4811704 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 1)

K6447102 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 2)

K6447103 1.0 ug DNA
EUR 154

Myo1f sgRNA CRISPR Lentivector (Rat) (Target 3)

K6447104 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 1)

K1378402 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 2)

K1378403 1.0 ug DNA
EUR 154

MYO1F sgRNA CRISPR Lentivector (Human) (Target 3)

K1378404 1.0 ug DNA
EUR 154

ELISA kit for Mouse Myosin-If (MYO1F)

KTE70871-48T 48T
EUR 332
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)

KTE70871-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myosin-If (MYO1F)

KTE70871-96T 96T
EUR 539
  • Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments (By
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myosin-If (MYO1F) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MYO1F Protein Vector (Mouse) (pPB-C-His)

PV203610 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPB-N-His)

PV203611 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPM-C-HA)

PV203612 500 ng
EUR 1065

MYO1F Protein Vector (Mouse) (pPM-C-His)

PV203613 500 ng
EUR 1065

MYO1F Protein Vector (Rat) (pPB-C-His)

PV284046 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPB-N-His)

PV284047 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPM-C-HA)

PV284048 500 ng
EUR 1166

MYO1F Protein Vector (Rat) (pPM-C-His)

PV284049 500 ng
EUR 1166

MYO1F Protein Vector (Human) (pPB-C-His)

PV027397 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPB-N-His)

PV027398 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPM-C-HA)

PV027399 500 ng
EUR 329

MYO1F Protein Vector (Human) (pPM-C-His)

PV027400 500 ng
EUR 329

Myo1f 3'UTR Luciferase Stable Cell Line

TU113739 1.0 ml Ask for price

Myo1f 3'UTR GFP Stable Cell Line

TU163739 1.0 ml Ask for price

Myo1f 3'UTR Luciferase Stable Cell Line

TU213659 1.0 ml Ask for price

Myo1f 3'UTR GFP Stable Cell Line

TU263659 1.0 ml Ask for price

MYO1F 3'UTR GFP Stable Cell Line

TU065082 1.0 ml
EUR 1394

MYO1F 3'UTR Luciferase Stable Cell Line

TU015082 1.0 ml
EUR 1394

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4811705 3 x 1.0 ug
EUR 376

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6447105 3 x 1.0 ug
EUR 376

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1378405 3 x 1.0 ug
EUR 376

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4811706 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4811707 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4811708 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6447106 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6447107 1.0 ug DNA
EUR 167

Myo1f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6447108 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1378406 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1378407 1.0 ug DNA
EUR 167

MYO1F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1378408 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody

A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody

A06873-1 100ug/vial
EUR 294

Anti-Adam28 Antibody

A06873-2 100ug/vial
EUR 334

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody

A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody

A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody

A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-AKR7A2 Antibody

A06949-1 100ug/vial
EUR 334

Anti-IPMK Antibody

A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody

A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody

A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.

Anti-SGK269 Antibody

A06989 100ul
EUR 397
Description: Rabbit Polyclonal SGK269 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MAST205 Antibody

A07003 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MAST205 Antibody (MAST2) detection.tested for WB in Human, Mouse.

Anti-TFF2 Antibody

A07013-1 100ug/vial
EUR 334

Anti-TFF2 Antibody

A07013-2 100ug/vial
EUR 334

Anti-FOXK1 Antibody

A07015 100ul
EUR 397
Description: Rabbit Polyclonal FOXK1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MYO1F Antibody