An ATF 24 peptide-functionalized β-elemene-nanostructured lipid service mixed


An ATF 24 peptide-functionalized β-elemene-nanostructured lipid service mixed with cisplatin for bladder most cancers remedy

Goal: On this examine, we aimed to develop an amino-terminal fragment (ATF) peptide-targeted liposome carrying β-elemene (ATF24-PEG-Lipo-β-E) for focused supply into urokinase plasminogen activator receptor-overexpressing bladder most cancers cells mixed with cisplatin (DDP) for bladder most cancers remedy. 

Strategies: The liposomes have been ready by ethanol injection and high-pressure microjet homogenization. The liposomes have been characterised, and the drug content material, entrapment effectivity, and in vitro launch have been studied. The focusing on effectivity was investigated utilizing confocal microscopy, ultra-fast liquid chromatography, and an orthotopic bladder most cancers mannequin.

The consequences of ATF24-PEG-Lipo-β-E mixed with DDP on cell viability and proliferation have been evaluated by a Cell Counting Package-8 (CCK-8) assay, a colony formation assay, and cell apoptosis and cell cycle analyses. The anticancer results have been evaluated in a KU-19-19 bladder most cancers xenograft mannequin. 

Outcomes: ATF24-PEG-Lipo-β-E had small and uniform sizes (˜79 nm), excessive drug loading capability (˜5.24 mg/mL), excessive entrapment effectivity (98.37 ± 0.95%), and exhibited sustained drug launch habits. ATF24-PEG-Lipo-β-E had higher focusing on effectivity and better cytotoxicity than polyethylene glycol (PEG)ylated β-elemene liposomes (PEG-Lipo-β-E). DDP, mixed with ATF24-PEG-Lipo-β-E, exerted a synergistic impact on mobile apoptosis and cell arrest on the G2/M part, and these results have been depending on the caspase-dependent pathway and Cdc25C/Cdc2/cyclin B1 pathways.

Moreover, the in vivo antitumor exercise confirmed that the focused liposomes successfully inhibited the expansion of tumors, utilizing the mixed technique. 

Conclusions: The current examine supplied an efficient technique for the focused supply of β-elemene (β-E) to bladder most cancers, and a mixed technique for bladder most cancers remedy. 


CCRL2 Antibody

45411-100ul 100ul
EUR 252

CCRL2 Antibody

45411-50ul 50ul
EUR 187

CCRL2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCRL2. Recognizes CCRL2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCRL2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCRL2. Recognizes CCRL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CCRL2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCRL2. Recognizes CCRL2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

CCRL2 Antibody

DF8643 200ul
EUR 304
Description: CCRL2 Antibody detects endogenous levels of total CCRL2.

CCRL2 antibody

70R-50662 100 ul
EUR 244
Description: Purified Polyclonal CCRL2 antibody

CCRL2 antibody

70R-5949 50 ug
EUR 467
Description: Rabbit polyclonal CCRL2 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCRL2 Antibody

ABD8643 100 ug
EUR 438


YF-PA16042 50 ug
EUR 363
Description: Mouse polyclonal to CCRL2


YF-PA16043 100 ug
EUR 403
Description: Rabbit polyclonal to CCRL2

Substance P reversed sequence Peptide

  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0001 1.0mg
EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0005 5.0mg
EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

CCRL2 Conjugated Antibody

C45411 100ul
EUR 397

CCRL2 cloning plasmid

CSB-CL004852HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atggccaattacacgctggcaccagaggatgaatatgatgtcctcatagaaggtgaactggagagcgatgaggcagagcaatgtgacaagtatgacgcccaggcactctcagcccagctggtgccatcactctgctctgctgtgtttgtgatcggtgtcctggacaatctcctgg
  • Show more
Description: A cloning plasmid for the CCRL2 gene.

CCRL2 cloning plasmid

CSB-CL004852HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Show more
Description: A cloning plasmid for the CCRL2 gene.

CCRL2 Polyclonal Antibody

ABP50893-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CCRL2 at AA range: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of CCRL2 from Human. This CCRL2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CCRL2 at AA range: 110-190

CCRL2 Polyclonal Antibody

ABP50893-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CCRL2 at AA range: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of CCRL2 from Human. This CCRL2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CCRL2 at AA range: 110-190

CCRL2 Polyclonal Antibody

ABP50893-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CCRL2 at AA range: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of CCRL2 from Human. This CCRL2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CCRL2 at AA range: 110-190

CCRL2 Polyclonal Antibody

ES1892-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCRL2 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

CCRL2 Polyclonal Antibody

ES1892-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCRL2 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

anti- CCRL2 antibody

FNab01393 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: chemokine(C-C motif) receptor-like 2
  • Uniprot ID: O00421
  • Gene ID: 9034
  • Research Area: Signal Transduction
Description: Antibody raised against CCRL2

Anti-CCRL2 antibody

PAab01393 100 ug
EUR 355

Anti-CCRL2 antibody

STJ92079 200 µl
EUR 197
Description: Rabbit polyclonal to CCRL2.

CCRL2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCRL2. Recognizes CCRL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCRL2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCRL2. Recognizes CCRL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCRL2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCRL2. Recognizes CCRL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF008475 96 Tests
EUR 689

Mouse CCRL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCRL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCRL2 Recombinant Protein (Human)

RP006244 100 ug Ask for price

CCRL2 Recombinant Protein (Human)

RP006247 100 ug Ask for price

CCRL2 Recombinant Protein (Human)

RP037861 100 ug Ask for price

CCRL2 Recombinant Protein (Rat)

RP193799 100 ug Ask for price

CCRL2 Recombinant Protein (Mouse)

RP122291 100 ug Ask for price

Anti-CCRL2/Cram A Antibody

A09152 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CCRL2 Antibody (CCRL2) detection.tested for WB in Human.

Polyclonal CCRL2 Antibody (Cytoplasmic Domain)

APR11029G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCRL2 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal CCRL2 Antibody (Cytoplasmic Domain)

APR11030G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCRL2 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Ccrl2 ORF Vector (Rat) (pORF)

ORF064601 1.0 ug DNA
EUR 506

CCRL2 ORF Vector (Human) (pORF)

ORF002082 1.0 ug DNA
EUR 95

CCRL2 ORF Vector (Human) (pORF)

ORF002083 1.0 ug DNA
EUR 95

CCRL2 ORF Vector (Human) (pORF)

ORF012621 1.0 ug DNA
EUR 354

Ccrl2 ORF Vector (Mouse) (pORF)

ORF040765 1.0 ug DNA
EUR 95

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672

Chemical modifications of tryptophan residues in peptides and proteins

Chemical protein modifications facilitate the investigation of pure posttranslational protein modifications and permit the design of proteins with new features. Proteins will be modified at a late stage on amino acid aspect chains by chemical strategies.

The indole moiety of tryptophan residues is an rising goal of such chemical modification methods due to its distinctive reactivity and low abundance. This assessment supplies an outline of the lately developed strategies of tryptophan modification on the peptide and protein ranges. 

Environment friendly isolation and quantification of circulating tumor cells in non-small cell lung most cancers sufferers utilizing peptide-functionalized magnetic nanoparticles

Background: Circulating tumor cells (CTCs) carry a wealth of knowledge on main and metastatic tumors vital for enhancing the understanding of the prevalence, development and metastasis of non-small cell lung most cancers (NSCLC). Nonetheless, the low sensitivity of conventional tumor detection strategies limits the appliance of CTCs within the remedy and illness surveillance of NSCLC. Subsequently, CTCs isolation and detection with excessive sensitivity is very desired particularly for NSCLC sufferers, which is important due to excessive prevalence and mortality.

Whereas it is extremely difficult due to the decrease expression of CTC optimistic biomarkers comparable to epithelial cell adhesion molecules and cytokeratins (EpCAM and CKs), herein we report a technique based mostly on peptide-functionalized magnetic nanoparticles with excessive CTC seize effectivity, which demonstrates superiority in NSCLC scientific functions.

Strategies: For evaluation and comparability of the peptide-functionalized magnetic nanoparticles (TumorFisher, Nanopep Corp.) and the antibody-modified magnetic beads (CellSearch, Janssen Diagnostics, LLC), two NSCLC cell traces, A549 and NCI-H1975 have been chosen to measure the binding affinity and seize effectivity. To be able to examine the impact of the scientific software of those two detection methods, 7 early stage sufferers with NSCLC have been enrolled on this examine.

To additional discover the scientific utility of CTC counting in several levels, 81 NSCLC sufferers in stage I-IV have been enrolled for CTC enumeration and statistical evaluation.

Outcomes: The binding affinities of the popularity peptide to A549 and NCI-H1975 are 76.7%±11.0% and 70.1%±4.8%, respectively, which is analogous with the optimistic management group (anti-EpCAM antibodies). CTCs have been captured in 5/7 (71.4%) of early stage NSCLC sufferers with NSCLC in TumorFisher system, which is greater than CellSearch, and the false destructive of TumorFisher is far decrease than CellSearch.

In a bigger scientific cohort, the CTC numbers of NSCLC sufferers assorted in several levels and the general detection price of TumorFisher was 59/81 (72.8%), with the same proportion in stage I (21/29, 72.4%), II (17/22, 77.3%) and III (16/21, 76.2%).

Conclusions: Extremely environment friendly CTC isolation approach based mostly on peptide-magnetic nanoparticles was firstly utilized in NSCLC sufferers. In contrast with the antibody-based the approach, the upper CTC detection charges (71.4%) in NSCLC affected person blood samples have been demonstrated for the sufferers in several levels, I-IV, particularly in early levels.

This means the feasibility of the scientific utility of this new approach in early stage screening, prognosis and remedy analysis of NSCLC. 

GRIK4 antibody
20R-1334 100 ug
EUR 377
Description: Rabbit polyclonal GRIK4 antibody
GRIK4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRIK4. Recognizes GRIK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GRIK4 Polyclonal Antibody
28355-100ul 100ul
EUR 252
GRIK4 Polyclonal Antibody
28355-50ul 50ul
EUR 187
GRIK4 Rabbit pAb
A13800-100ul 100 ul
EUR 308
GRIK4 Rabbit pAb
A13800-200ul 200 ul
EUR 459
GRIK4 Rabbit pAb
A13800-20ul 20 ul
EUR 183
GRIK4 Rabbit pAb
A13800-50ul 50 ul
EUR 223
GRIK4 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GRIK4 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GRIK4 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Polyclonal Grik4 Antibody
AMM05977G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Grik4 . This antibody is tested and proven to work in the following applications:
Polyclonal Grik4 Antibody
AMM05978G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Grik4 . This antibody is tested and proven to work in the following applications:
Anti-GRIK4 antibody
STJ115744 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
GRIK4 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRIK4. Recognizes GRIK4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GRIK4 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRIK4. Recognizes GRIK4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GRIK4 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRIK4. Recognizes GRIK4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Rat GRIK4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GRIK4 Polyclonal Conjugated Antibody
C28355 100ul
EUR 397
Human GRIK4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GRIK4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Grik4 ORF Vector (Rat) (pORF)
ORF067887 1.0 ug DNA
EUR 506
GRIK4 ORF Vector (Human) (pORF)
ORF020421 1.0 ug DNA
EUR 405
Grik4 ORF Vector (Mouse) (pORF)
ORF046667 1.0 ug DNA
EUR 506
pECMV-Grik4-m-FLAG Plasmid
PVT15012 2 ug
EUR 325
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 557
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 774
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 533
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 740
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643
Polyclonal GRIK4 Antibody - C-terminal region
APG03377G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRIK4 - C-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal GRIK4 / KA1 Antibody (C-Terminus)
AMM05976G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRIK4 / KA1 (C-Terminus). This antibody is tested and proven to work in the following applications:
Grik4 sgRNA CRISPR Lentivector set (Rat)
K6904601 3 x 1.0 ug
EUR 339
Grik4 sgRNA CRISPR Lentivector set (Mouse)
K3862901 3 x 1.0 ug
EUR 339
GRIK4 sgRNA CRISPR Lentivector set (Human)
K0906501 3 x 1.0 ug
EUR 339
Glutamate Receptor Ionotropic, Kainate 4 (GRIK4) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Grik4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6904602 1.0 ug DNA
EUR 154
Grik4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6904603 1.0 ug DNA
EUR 154
Grik4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6904604 1.0 ug DNA
EUR 154
Grik4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3862902 1.0 ug DNA
EUR 154
Grik4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3862903 1.0 ug DNA
EUR 154
Grik4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3862904 1.0 ug DNA
EUR 154
GRIK4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0906502 1.0 ug DNA
EUR 154
GRIK4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0906503 1.0 ug DNA
EUR 154